View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_469 (Length: 205)
Name: NF9795A_low_469
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_469 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 24 - 187
Target Start/End: Original strand, 52478151 - 52478313
Alignment:
| Q |
24 |
aaattaacattagatagtcatggtcatgagtgacgccatgccattgttgacggcctattagcaactggtctagaactgttgttattctcagtggacattt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52478151 |
aaattaacattagatagtcatggtcatgagtgacgccatgccattgttgacggcctattagcaactggtctagaactgttgttattctcagtggacattt |
52478250 |
T |
|
| Q |
124 |
acaccatcactttaccgttttttatttgtataagttaattataacggtgatcttttttaatatt |
187 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52478251 |
acaccatcactttacc-tttattatttgtataagtaaattataacggtgatcttttttaatatt |
52478313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University