View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_456 (Length: 208)
Name: NF9795A_low_456
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_456 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 3675534 - 3675341
Alignment:
| Q |
1 |
tatgatgggtttttgtcaaaatttaatttgtatggaactttaattaataannnnnnnaatcttaggtatttgcttgtggtagcattttttacaagtatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3675534 |
tatgatgggtttttgtcaaaatttaatttgtatggaactttaattaataatttttttaatcttaggtatttgcttgtggtagcattttttacaagtatat |
3675435 |
T |
|
| Q |
101 |
acacaggaagccaagtgtatcgtcaaattcatgaacttatcactgggaataatatatttcgacctacaactgcagctgtgattgatattgttgg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3675434 |
acacaggaagccaagtgtatcgtcaaattcatgaacttatcactgggaataatatatttcgacctacaactgcagctgtgattgattttgttgg |
3675341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University