View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_440 (Length: 217)
Name: NF9795A_low_440
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_440 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 12416239 - 12416023
Alignment:
| Q |
1 |
tgcttctgctttgttcaattttagttgccatatgtactaatcctgtcttaatttcttgcaagcaaatccttcagannnnnnnn--gcctaatgtgtctta |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
12416239 |
tgcttctgctttgttcaattttagttgccatatgtactaatcctgtcttaatttcttgcaagcaaatctttcagatttttgttttgcctaatgtgtctta |
12416140 |
T |
|
| Q |
99 |
ataacgcactagatcatgtcatgatatatat----ggagtatttgtttgtgactcaccagcatgtcaaaatctgttttttgtttgtaaaacatctttgtt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12416139 |
ataacgcactagatcatgtcatgatatatatctatggagtatttgtttgtgactcaccagcatgtcaaaatctgttttttgtttgtaaaacatctttgtt |
12416040 |
T |
|
| Q |
195 |
gatgtccatctcattgtt |
212 |
Q |
| |
|
||| | |||||||||||| |
|
|
| T |
12416039 |
gatat-catctcattgtt |
12416023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 12428299 - 12428083
Alignment:
| Q |
1 |
tgcttctgctttgttcaattttagttgccatatgtactaatcctgtcttaatttcttgcaagcaaatccttcagannnnnnnn--gcctaatgtgtctta |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
12428299 |
tgcttctgctttgttcaattttagttgccatatgtactaatcctgtcttaatttcttgcaagcaaatctttcagatttttgttttgcctaatgtgtctta |
12428200 |
T |
|
| Q |
99 |
ataacgcactagatcatgtcatgatatatat----ggagtatttgtttgtgactcaccagcatgtcaaaatctgttttttgtttgtaaaacatctttgtt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12428199 |
ataacgcactagatcatgtcatgatatatatctatggagtatttgtttgtgactcaccagcatgtcaaaatctgttttttgtttgtaaaacatctttgtt |
12428100 |
T |
|
| Q |
195 |
gatgtccatctcattgtt |
212 |
Q |
| |
|
||| | |||||||||||| |
|
|
| T |
12428099 |
gatat-catctcattgtt |
12428083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 126 - 190
Target Start/End: Complemental strand, 12402298 - 12402229
Alignment:
| Q |
126 |
atatggagtatttgtttgtgactcaccag-----catgtcaaaatctgttttttgtttgtaaaacatctt |
190 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12402298 |
atatggagtatttgtttgtgactcaccagaccagcatgtcaaaatctgtttgttgtttgtaaaacatctt |
12402229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University