View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_365 (Length: 230)
Name: NF9795A_low_365
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_365 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 34884261 - 34884115
Alignment:
| Q |
1 |
ggtacaattcgataacaatgtattgatacttaaaaggtcattctttacttgcatgtgtaggggattacataaataaactattagtttccttttgctccat |
100 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34884261 |
ggtacaattcgataacaatgtaatgattcttaaagggtcattctttacttgcatgtgtaggggactacataaataaactattagtttccttttgctccat |
34884162 |
T |
|
| Q |
101 |
aaataaattgaatttgaatttcagtgtttgtgagttgtgaccaatta |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34884161 |
aaataaattgaatttgaatttcagtgtttgtgagttgtgaccaatta |
34884115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University