View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_322 (Length: 239)
Name: NF9795A_low_322
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_322 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 21 - 228
Target Start/End: Original strand, 27060307 - 27060514
Alignment:
| Q |
21 |
tgcttttcaatttttgcggggatcgtaagatgatcagcaaagaccttttaacctgatttctataatgaccattctgacgattctgccatccattgtcatg |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27060307 |
tgcttttcaatttttgcggggatcgtaagatgatcagaagagaccttttaacctgatttctatgatgaccattctgacgattctgccatccattgtcatg |
27060406 |
T |
|
| Q |
121 |
gtttgttgtttgttttggatgagtggtctgctttgcaagttgttgttttacttgctttgtgtacaacttgcggcaagtattatggcctcgatgttgttgt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27060407 |
gtttgttgtttgttttggatgagtggtctgctttgcaagttgttgttttacttgctttatgtacaacttgcggcaagtattatggactcgatgttgttgt |
27060506 |
T |
|
| Q |
221 |
gatgtcca |
228 |
Q |
| |
|
||||||| |
|
|
| T |
27060507 |
tatgtcca |
27060514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University