View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_312 (Length: 241)
Name: NF9795A_low_312
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_312 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 42 - 229
Target Start/End: Complemental strand, 33817621 - 33817434
Alignment:
| Q |
42 |
ggacaacataagactttggtgagtcgggaccttgtcgaggagcagtttccaagaaaatgcgatatctttttccggattaacactcttccaaaccttagaa |
141 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33817621 |
ggacaacataagactttgatgagtcggggccttgtcgaggagcagttttcaagaaaatgcgataactttttccggattaacactcttccaaaccttagaa |
33817522 |
T |
|
| Q |
142 |
atgatttggagttgatccatcgagaaaggtagatttgccgagaaagtccaataagtcaagttattcgagtaaataccactagaattat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33817521 |
atgatttggagttgatccatcgagaaagatagatttgccgagagagtccaataagtcaagttattcgagtaaataccactagtattat |
33817434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University