View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_284 (Length: 245)
Name: NF9795A_low_284
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_284 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 14 - 245
Target Start/End: Original strand, 5538301 - 5538532
Alignment:
| Q |
14 |
acatcatcagtcaatcaaaataaacctttcatcaaaataacacctcaaatattaaatcaacattgacgatctttatccatcaatgtcacacaaaactaaa |
113 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
5538301 |
acataatcagtcgatcaaaataaacctttcatcaaaataacacctcaaatattaaatcaacattgacgatctttatccatcaatgtcacacaaaaccaaa |
5538400 |
T |
|
| Q |
114 |
acgatcttttgcagttgttatctaagattgtgacttttctatcgttatcaacaatgagttgggatgtattctttagaacatttaactgtttatagaagtg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5538401 |
acgatcttttgcagttgttatctaagattatgacttttctatcgttatcagcaatgagttgggatgtattctttagaacatttaactgtttatagaagtg |
5538500 |
T |
|
| Q |
214 |
gacgaaaaataaatattggtctggcattctaa |
245 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| |
|
|
| T |
5538501 |
gatgaaaaataaatattggtctggcattctaa |
5538532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University