View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_276 (Length: 245)
Name: NF9795A_low_276
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_276 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 12 - 245
Target Start/End: Original strand, 43669522 - 43669755
Alignment:
| Q |
12 |
tgaaagtggcttacaaagacttggttcaaattggtggtttactcattgatgtatacgtgactgttccattaagaaatttaaatggattgatcttaatcgg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43669522 |
tgaaagtggcttacaaagacttggttcaaattggtggtttactcattgatgtatatgtgactgttccattaagaaatttaaatggattgatcttaatcgg |
43669621 |
T |
|
| Q |
112 |
atacccttaaatgtaccgaccatgttttgcatccaattcattcagatcccaagttgtcttgcnnnnnnnnnnnnncacattataatgattgcatatttat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43669622 |
atacccttaaatgtaccgaccatgttttgcatccaattcattcagatcccaagttgtcttgcaaaaatgaaaaaacacattataatgattgcatatttat |
43669721 |
T |
|
| Q |
212 |
ggttaagcattgcatgatgatttagtactatcat |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
43669722 |
ggttaagcattgcatgatgatttagtactatcat |
43669755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University