View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_254 (Length: 248)
Name: NF9795A_low_254
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_254 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 35880836 - 35881070
Alignment:
| Q |
1 |
acatcaatgctggttatgcagggtaaagtatatactttgtaaaagattagnnnnnnnngttgaactttgtgtggatttgttgatgccaatcttatctaac |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
35880836 |
acatgaatgctggttatgcagggtaaagtatatactttgtaaaagattagttttttttgttgaactttgtgtggatttattgatgtcaatcttatctaac |
35880935 |
T |
|
| Q |
101 |
acttgtgtcaactgaagttggctagtttccaccaaacttcagtcaaattgataccgattgtcttatttttcagatttgccgcatctctcattgatagacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35880936 |
acttgtgtcaactgaagttggctagtttccaccaaacttcagtcaaattgataccgattgtcttatttttcagatttgccgcatctcttattgatagacc |
35881035 |
T |
|
| Q |
201 |
aatctgggtgatgaatgtagtacctattgatgtcc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
35881036 |
aatctgggtgatgaatgtagtacctattgatgtcc |
35881070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 166 - 231
Target Start/End: Complemental strand, 32096451 - 32096386
Alignment:
| Q |
166 |
tttttcagatttgccgcatctctcattgatagaccaatctgggtgatgaatgtagtacctattgat |
231 |
Q |
| |
|
|||||||||||||| ||| |||| || ||| ||||| | |||||||||||||||||||| |||||| |
|
|
| T |
32096451 |
tttttcagatttgctgcagctcttatcgatcgaccattgtgggtgatgaatgtagtaccaattgat |
32096386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University