View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_219 (Length: 250)
Name: NF9795A_low_219
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_219 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 15 - 250
Target Start/End: Original strand, 1123794 - 1124029
Alignment:
| Q |
15 |
atggacatcatgaggccatttgcagaatctgttttgagtgggtgagtcatttgnnnnnnnnnnnnnncttnnnnnnncaaattattagtatcttcttcat |
114 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
1123794 |
atggacataatgaagccatttgcagaatctgttttgagtgggtgagtcatttgttttttctttttttcttaaaaaaacaaattattagtatcttcttcat |
1123893 |
T |
|
| Q |
115 |
tgcttgtttcacctatggctgacatgaggtggacttcccaggtttattaatagaggaccatcagtaaatgatagatgggtttttgattccccagtccatt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1123894 |
tgcttgtttcacctatggctgacatgaggttgacttcccaggtttattaatagaggaccatcagtaaatgatagatgggtttttgattccccagtccatt |
1123993 |
T |
|
| Q |
215 |
ctaacgttgaagctaagctgaggcaacttttaattg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
1123994 |
ctaacgttgaagctaagctgaggcaacttttaattg |
1124029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University