View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9795A_low_204 (Length: 252)
Name: NF9795A_low_204
Description: NF9795A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9795A_low_204 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 6 - 145
Target Start/End: Complemental strand, 3645226 - 3645084
Alignment:
| Q |
6 |
aagtacttcttcaaacttgcgattatcat---gttatgagatcgttttcaccaatcacaatgaataatagaaggtacaaagtgtagctttgtattgaaaa |
102 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3645226 |
aagtacttcttcaaacttgcgattatcatcatgttatgagatcgttttcaccaatcacaatgaataatagaaggtacaaagtgtagctttgtattgaaaa |
3645127 |
T |
|
| Q |
103 |
cacgtctacgataattcccaatgcaataacaatcatgttataa |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3645126 |
cacgtctacgataattcccaatgcaataacaatcatgatataa |
3645084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University