View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8361_high_3 (Length: 516)
Name: NF8361_high_3
Description: NF8361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8361_high_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 435; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 435; E-Value: 0
Query Start/End: Original strand, 18 - 496
Target Start/End: Original strand, 7750350 - 7750828
Alignment:
| Q |
18 |
gagcttgttatgggagacatcaagaagagacagagccggcaggtttccgagagaggcctgaattgggccagaaaaacggttatttgctaggacgattaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7750350 |
gagcttgttatgggagacatcaagaagagacagagccggcaggtttccgagagaggccggaattgggccagaaaaacggttatttgctaggacgattaag |
7750449 |
T |
|
| Q |
118 |
gtgaggttttttaaacggcccaagaacgatggaattggtccactaagtctgtttgtgtccagcacaaggaggttaaggtttgtcagcttgctcaaggaat |
217 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7750450 |
gtgagcttttttaaacggcccaagaacgatggaattggtccactaagtctgtttgtgtcgagcacaaggaggttaaggtttgtcagcttgctcaaggaat |
7750549 |
T |
|
| Q |
218 |
ttggtattgtaccggtgagatggtttgcgcgaagattgagattattaagtctagacagttgaccaagagatgacggtatagagccagaaaatctgttggc |
317 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7750550 |
tcggtattgtaccggtgagatggtttgcgcgaaggttgagattattaagtctagacagttgaccaagagatgatggtatagagccagaaaatctgttggc |
7750649 |
T |
|
| Q |
318 |
gtaaagcatgagccctgttagcctcttgagccggcccagggagggtgggattgggccggaaagtttgtttgctccaaaggtaatgctaatgaggttcgtc |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7750650 |
gtaaagcatgagccctgttagcctcttgagccggcccagggagggtgggattgggccggaaagtttgtttgctccaaagttaatgctaatgaggttcgtc |
7750749 |
T |
|
| Q |
418 |
agttggctaagagatgatggaattgggccggaaaggctgttggaagagaagtcaatgaaagttaggcccttgagtaggg |
496 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| ||| |||||||||||||| |
|
|
| T |
7750750 |
agttggctaagagatgatggaattgggccggaaaggctgttggaagagaagtcgataaaatttacgcccttgagtaggg |
7750828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University