View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2889_low_14 (Length: 318)
Name: NF2889_low_14
Description: NF2889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2889_low_14 |
 | |
|
| [»] chr2 (226 HSPs) |
| |
|
| [»] chr8 (211 HSPs) |
| |
|
| [»] chr7 (215 HSPs) |
| |
|
| [»] scaffold0712 (1 HSPs) |
| |
|
| [»] scaffold0709 (1 HSPs) |
| |
|
| [»] scaffold0535 (2 HSPs) |
| | |
|
| [»] scaffold0021 (2 HSPs) |
| | |
|
| [»] scaffold0210 (2 HSPs) |
| | |
|
| [»] scaffold0166 (2 HSPs) |
| | |
|
| [»] scaffold0056 (3 HSPs) |
| | |
|
| [»] scaffold1001 (2 HSPs) |
| | |
|
| [»] scaffold0373 (1 HSPs) |
| | |
|
| [»] scaffold0026 (3 HSPs) |
| |
|
| [»] scaffold0024 (2 HSPs) |
| |
|
| [»] scaffold0003 (2 HSPs) |
| | |
|
| [»] scaffold0337 (1 HSPs) |
| | |
|
| [»] scaffold0051 (2 HSPs) |
| | |
|
| [»] scaffold0811 (2 HSPs) |
| | |
|
| [»] scaffold0347 (2 HSPs) |
| | |
|
| [»] scaffold0370 (1 HSPs) |
| | |
|
| [»] scaffold0179 (1 HSPs) |
| | |
|
| [»] scaffold0159 (1 HSPs) |
| | |
|
| [»] scaffold0065 (2 HSPs) |
| | |
|
| [»] scaffold0001 (3 HSPs) |
| |
|
| [»] scaffold0060 (2 HSPs) |
| | |
|
| [»] scaffold0123 (1 HSPs) |
| | |
|
| [»] scaffold0326 (4 HSPs) |
| | |
|
| [»] scaffold0684 (2 HSPs) |
| | |
|
| [»] scaffold0105 (2 HSPs) |
| | |
|
| [»] scaffold0160 (2 HSPs) |
| |
|
| [»] scaffold0016 (2 HSPs) |
| | |
|
| [»] scaffold0002 (2 HSPs) |
| | |
|
| [»] scaffold0005 (3 HSPs) |
| | |
|
| [»] scaffold0578 (1 HSPs) |
| | |
|
| [»] scaffold0472 (1 HSPs) |
| |
|
| [»] scaffold0860 (1 HSPs) |
| | |
|
| [»] scaffold0078 (2 HSPs) |
| | |
|
| [»] scaffold0119 (1 HSPs) |
| | |
|
| [»] scaffold0176 (1 HSPs) |
| | |
|
| [»] scaffold0011 (2 HSPs) |
| | |
|
| [»] scaffold0339 (1 HSPs) |
| | |
|
| [»] scaffold0008 (1 HSPs) |
| | |
|
| [»] scaffold0007 (2 HSPs) |
| | |
|
| [»] scaffold0085 (1 HSPs) |
| | |
|
| [»] scaffold0817 (1 HSPs) |
| | |
|
| [»] scaffold0103 (1 HSPs) |
| | |
|
| [»] scaffold0147 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 240; Significance: 1e-133; HSPs: 192)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 293
Target Start/End: Original strand, 38962583 - 38962875
Alignment:
| Q |
1 |
accagcaacttttaacgctaaactggtgtatacatccagctatcttaacttgaacaaagcatttttcaactccaaagaaccccatctattaaagctcttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
38962583 |
accagcaacttttaacgctaaactggtgtatacatccagctatcttaacttgaacaaagcatttttcaactccaaagaaccccttctgttaaagctcttt |
38962682 |
T |
|
| Q |
101 |
ttactaatagcttcatcatttgcaagccacatagcctacaaacaaacnnnnnnnggtcatgaagttgtgtattttgaaaaggacgatcaactttcaacct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38962683 |
ttactaatagcttcatcatttgcaagccacatagcctacaaacaaacaaaaaaaggtcatgaagttgtgtattttgaaaaggacgatcaactttcaacct |
38962782 |
T |
|
| Q |
201 |
aagtaacaacgaagttttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattt |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||| ||||||||||||| | |||||||| ||||||| |
|
|
| T |
38962783 |
aagtaacaacgaagttttatgttggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcttgtaaaaaaaaaattt |
38962875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 5614530 - 5614440
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5614530 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaagaaaattttgtttttggtccctgcaaaat |
5614440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 29692744 - 29692838
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
29692744 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaagttttgtttttggtccctgcaaaatattt |
29692838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 2217494 - 2217584
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
2217494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaat |
2217584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 224 - 317
Target Start/End: Complemental strand, 19685380 - 19685287
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatatt |
317 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
19685380 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt |
19685287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 224 - 317
Target Start/End: Complemental strand, 24443744 - 24443651
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatatt |
317 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
24443744 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt |
24443651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 222 - 318
Target Start/End: Complemental strand, 35928460 - 35928364
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
35928460 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
35928364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 1381247 - 1381341
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
1381247 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
1381341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 5614166 - 5614256
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||| ||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5614166 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaaaaagaaaattttgtttttggtccctgtaaaat |
5614256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 24781989 - 24782079
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||| ||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
24781989 |
ggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgttaaaagaaaaatttgtttttggtccctgcaaaat |
24782079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 28863840 - 28863745
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaa---attttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| || |||||||||||||||||||||| |
|
|
| T |
28863840 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaatatatattgtttttggtccctgcaaaat |
28863745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 224 - 317
Target Start/End: Original strand, 37271359 - 37271452
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatatt |
317 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||| |||||||||||||||||||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
37271359 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt |
37271452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 7075572 - 7075660
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |||||||||||||||| ||||| |
|
|
| T |
7075572 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaa--ttgtttttggtccctgtaaaat |
7075660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 38786159 - 38786247
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
38786159 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
38786247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 1104858 - 1104948
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||||||||| ||| | |||||||||||||||||||||| |
|
|
| T |
1104858 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaat |
1104948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 16038377 - 16038466
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |||| |||||||||||||||||||||| |
|
|
| T |
16038377 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaa-aaaaaattgtttttggtccctgcaaaat |
16038466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 35877052 - 35876958
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||| ||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
35877052 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
35876958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 40764780 - 40764686
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
40764780 |
ggctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaaatattt |
40764686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 5950176 - 5950262
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
5950176 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa----tgtttttggtccctgcaaaat |
5950262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 224 - 317
Target Start/End: Original strand, 21124913 - 21125005
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatatt |
317 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
21124913 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaaaaa-aaaaaattgtttttggtccctgcaaaatatt |
21125005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 223 - 314
Target Start/End: Original strand, 26133182 - 26133270
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
26133182 |
tggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaaaaaaaaaa---tgtttttggtccctgcaaaat |
26133270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 222 - 314
Target Start/End: Original strand, 28550825 - 28550915
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |||| ||||||||||||| |||||||| |
|
|
| T |
28550825 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgttaaaaaaaaa--ttgtttttggtccttgcaaaat |
28550915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 225 - 314
Target Start/End: Original strand, 29172524 - 29172613
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||| |||||||||||||| |||||||| |
|
|
| T |
29172524 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccttgcaaaat |
29172613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 30800494 - 30800580
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
30800494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaa----ttgtttttggtccctgcaaaat |
30800580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 224 - 313
Target Start/End: Complemental strand, 35167165 - 35167077
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |||| |||||||||||||| ||||||| |
|
|
| T |
35167165 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgcaaaaa-aaaaatttgtttttggtccttgcaaaa |
35167077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 316
Target Start/End: Complemental strand, 5917460 - 5917368
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatat |
316 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||||||| |
|
|
| T |
5917460 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatat |
5917368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 226 - 318
Target Start/End: Complemental strand, 6912855 - 6912763
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| ||| | ||||||||||||| |||||||||||| |
|
|
| T |
6912855 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccatgcaaaatattt |
6912763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 226 - 314
Target Start/End: Complemental strand, 16038738 - 16038650
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||||||||| ||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtctctgtaaaaaaaaaaaattgtttttggtccctgcaaaat |
16038650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 18633599 - 18633688
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
18633599 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
18633688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 18633963 - 18633871
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
18633963 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttactccctggtaaaaaaaaaaattgtttttggtccctgcaaaat |
18633871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 40167786 - 40167873
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
40167786 |
ggctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaa---tgtttttggtccctgcaaaat |
40167873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 2217854 - 2217766
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |||| |||||||||||||||| ||||| |
|
|
| T |
2217854 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctataaaaaaaaaa--ttgtttttggtccctgtaaaat |
2217766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 4203770 - 4203682
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
4203770 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
4203682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 223 - 314
Target Start/End: Original strand, 25561704 - 25561795
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
25561704 |
tggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaat |
25561795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 36578083 - 36577996
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |||||||||||| |||||||||| |
|
|
| T |
36578083 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaa--aaaaatttgtttttggt-cctgcaaaat |
36577996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 223 - 312
Target Start/End: Original strand, 6912496 - 6912586
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| ||| || |||||||||||||||||||| |
|
|
| T |
6912496 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaatttgttgtttttggtccctgcaaa |
6912586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 313
Target Start/End: Complemental strand, 9179920 - 9179833
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||| |||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
9179920 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttattccctgtaaaaaaaaaa--ttgtttttggtccctgcaaaa |
9179833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 10743724 - 10743813
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |||| ||||||||||||||||||||| |
|
|
| T |
10743724 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaa-aaaaaaatgtttttggtccctgcaaaat |
10743813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 18258527 - 18258433
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||| |||||||| ||| | |||||||||||||| ||||||||||| |
|
|
| T |
18258527 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaaaaaaaaattgttgtttttggtccccgcaaaatattt |
18258433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 25779162 - 25779072
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |||| ||||||||| ||| |||||||| |
|
|
| T |
25779162 |
ggctaaaatatggttttagtccctgcaaatatgcttcattttggttttagttcctgtaaaaaaaaaaaattgtttttgatccttgcaaaat |
25779072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 26133413 - 26133324
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |||| ||||||||| |||| |||||||| |
|
|
| T |
26133413 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaa-aaaaatttgttttttgtccttgcaaaat |
26133324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 29172886 - 29172797
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| || | ||||||||||||||||||||||| |
|
|
| T |
29172886 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaa-aagaatttgtttttggtccctgcaaaat |
29172797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 313
Target Start/End: Original strand, 34125307 - 34125394
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||| |||| ||||||||||||||||||||| |
|
|
| T |
34125307 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaa--ttgtttttggtccctgcaaaa |
34125394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 223 - 307
Target Start/End: Complemental strand, 40029498 - 40029417
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccct |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
40029498 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccct |
40029417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 40168008 - 40167919
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| ||| |||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
40168008 |
ggctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtccctgtaaaaa-aaaaatttgtttttggtccctgcaaaat |
40167919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 18258162 - 18258251
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| ||||| |||||| |||||||||| ||||||||| |
|
|
| T |
18258162 |
ggctaaaatatggttttggtccctgcaaatatggctcattttggttttagtccctgcaaaaaaaaaattgttgtttttggcccctgcaaa |
18258251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 223 - 314
Target Start/End: Complemental strand, 21050914 - 21050826
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||| |||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
21050914 |
tggctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
21050826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 33336028 - 33335935
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta-aaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |||| |||| |||||||||||| ||||||||| |
|
|
| T |
33336028 |
ttggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgtaaaaaaaaaaaaattgtttttggtcgctgcaaaat |
33335935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 1105148 - 1105060
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
1105148 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
1105060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 15635707 - 15635618
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
15635707 |
ggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
15635618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 28863510 - 28863597
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| ||||||||| |||||||||||| |
|
|
| T |
28863510 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa---aaaaagttgtttttgctccctgcaaaat |
28863597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 304
Target Start/End: Complemental strand, 29875725 - 29875645
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtc |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
29875725 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaagaaaaattttgtttttggtc |
29875645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 35928064 - 35928152
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
35928064 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
35928152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 36577722 - 36577809
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
36577722 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggcccctgcaaaat |
36577809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 222 - 318
Target Start/End: Complemental strand, 40038860 - 40038764
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||| ||||||||||| |||||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
40038860 |
ttggctaaaatatgattttggtccctgcaaatatgccttgttttggttttaatccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattt |
40038764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 223 - 318
Target Start/End: Original strand, 45137 - 45232
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| || | ||||||||| ||| |||||||||||| |
|
|
| T |
45137 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttgatccttgcaaaatattt |
45232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 224 - 315
Target Start/End: Complemental strand, 31037741 - 31037650
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaata |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||| || |||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
31037741 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttattctctgtaaaacaaaaaaattgtttttggtccctgcaaaata |
31037650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 42207242 - 42207330
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||| || ||||||| ||| |||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
42207242 |
ggctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccctgtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
42207330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 10409326 - 10409236
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||||||| ||| |||| |||| |||||||||| |||||||||||| |
|
|
| T |
10409326 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtctctggtaaaaaaaaaatttgtttttgatccctgcaaaat |
10409236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 20986089 - 20985995
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||| ||||| | | |||||||||||||||||||||||||| |
|
|
| T |
20986089 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattt |
20985995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 36973710 - 36973616
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| ||| ||||| |||||||||||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
36973710 |
ggctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattt |
36973616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 39379610 - 39379520
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||| || |||| ||| ||||||||||||||||||||||| |
|
|
| T |
39379610 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttggtaaaaaaaacatttgtttttggtccctgcaaaat |
39379520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 225 - 318
Target Start/End: Complemental strand, 2636992 - 2636900
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||||| |||||||||| || | ||||||||||||| |||||||||||| |
|
|
| T |
2636992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt-cctgtaaaaaaaatttgttgtttttggtccttgcaaaatattt |
2636900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 10744054 - 10743968
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||| ||||||||||||||||||||||| |||| |||||||||||||||| |||| |
|
|
| T |
10744054 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgtaaaa--aaaaatttgtttttggtccctacaaa |
10743968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 224 - 313
Target Start/End: Original strand, 18046038 - 18046126
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||||||| ||| ||||||||||||| ||| ||||| |
|
|
| T |
18046038 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaaaa-aaagttttgtttttggttcctacaaaa |
18046126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 224 - 285
Target Start/End: Complemental strand, 34125632 - 34125571
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34125632 |
ggctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgtaaaaa |
34125571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 11799458 - 11799371
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
| T |
11799458 |
ggctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccctgtaaaaaataaa---tgtttttggtccctacaaaat |
11799371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 19565831 - 19565743
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| | | |||||||||||||||||||| |
|
|
| T |
19565831 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
19565743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 222 - 314
Target Start/End: Original strand, 29151514 - 29151606
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||| |||||||||||| |||| |||| |||||||||||| |||| ||||| |
|
|
| T |
29151514 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaatttgtttttggttcctgtaaaat |
29151606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 29875400 - 29875487
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||| |||||||||||||||||| |||| |||| ||||||||||||||||||||| |
|
|
| T |
29875400 |
ggctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaa-aaaaatttgtttttggtccctgcaaa |
29875487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 35876688 - 35876776
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| || |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
35876688 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
35876776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 6118501 - 6118405
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg----taaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| ||||| |||| |||||||||||||||||||||| |
|
|
| T |
6118501 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctggtaaaaaaaaaaaaaaattgtttttggtccctgcaaaat |
6118405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 21050575 - 21050663
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||| || ||||| |||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
21050575 |
ggctaaaatatgattttagtccctacaaatatgcttcgttttgattttagtccctgtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
21050663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 226 - 312
Target Start/End: Complemental strand, 27850372 - 27850288
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||| ||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
27850372 |
ctaaaatatgattttagtctctgcaaatatgtctcgttttggttttagtccctataaaa--aaaattttgtttttggtccctgcaaa |
27850288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 222 - 313
Target Start/End: Original strand, 3850297 - 3850386
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttgg-ttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |||||| |||||||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
3850297 |
ttggctaaaatatggttttagtccctgcaaatctgcctcgttttggtttttagtccctgtaaaaaaaaa---ttgtttttggtccgtgcaaaa |
3850386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 290
Target Start/End: Complemental strand, 18046348 - 18046282
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaa |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |||| |
|
|
| T |
18046348 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaa |
18046282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 310
Target Start/End: Original strand, 20660948 - 20661034
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgca |
310 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |||||||| || | ||||||||||||| |||| |
|
|
| T |
20660948 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaatgtgttgtttttggtccttgca |
20661034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 222 - 312
Target Start/End: Original strand, 20985723 - 20985813
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| | | |||||||||||||||||||| |
|
|
| T |
20985723 |
ttggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
20985813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 227 - 312
Target Start/End: Original strand, 28871640 - 28871726
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||| |||| |||||||||||||| | || |||||||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
28871640 |
taaaatatgattttggtccctgcaaatatccttcgttttggttttagtccctgtaaaaaaaaaattgttgtttttggtccctgcaaa |
28871726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 30800850 - 30800792
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30800850 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
30800792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 38496782 - 38496693
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||||||||| |||| |||| ||||||||||||||||| ||||| |
|
|
| T |
38496782 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctggtaaaa-aaaaatttgtttttggtccctgtaaaat |
38496693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 215 - 312
Target Start/End: Original strand, 2636660 - 2636757
Alignment:
| Q |
215 |
ttttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||| | ||| |||||||||||||| ||| ||||| || | |||||||||||||||||||| |
|
|
| T |
2636660 |
ttttttgttggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtctctgcaaaaaaaatttgttgtttttggtccctgcaaa |
2636757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 225 - 314
Target Start/End: Original strand, 27916462 - 27916551
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||| | ||||| |||||||||||| || ||||||||||||||||||||| || ||| |||||||||||||||||||||||| |
|
|
| T |
27916462 |
gctaaaatatgatcttagttcctgcaaatatgtttcgttttggttttagtccctgtaagaaaaaagttttgtttttggtccctgcaaaat |
27916551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 1381611 - 1381523
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
1381611 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaattttttgttgtttttggtccctgcaaa |
1381523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 4736542 - 4736454
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || |||||||||||||||||||||||| || | |||||||||||| ||||||| |
|
|
| T |
4736542 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtctctgcaaa |
4736454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 9179593 - 9179680
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| || |||||||||||||||||||||||| |||| ||| |||||||||||||||| |
|
|
| T |
9179593 |
ggctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctgtaaaaa-aaaaaattgattttggtccctgcaaa |
9179680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 227 - 314
Target Start/End: Complemental strand, 9532532 - 9532444
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt-aaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||| ||| ||||| |||| ||||||||||||| |||||||| |
|
|
| T |
9532532 |
taaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaaaaattgtttttggtccttgcaaaat |
9532444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 14318045 - 14318132
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||| ||||||||||||||| |||||||| ||| ||||||||||||| |||||||| |
|
|
| T |
14318045 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccttgtaaaaaaaaa---ttgtttttggtccttgcaaaat |
14318132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 29693090 - 29693003
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| || ||||||||||||||| |||||||| ||| ||||||||||||||| |||||| |
|
|
| T |
29693090 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtccttgtaaaaaaaaa---ttgtttttggtccctacaaaat |
29693003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 226 - 314
Target Start/End: Original strand, 31037397 - 31037485
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||| |||||||| |||||||| |||| ||||||||| ||||||||||||| |
|
|
| T |
31037397 |
ctaaaatatggttttagtccctgcaaatataccttgttttgattttagtctctgtaaaataaaaaatttgttttttgtccctgcaaaat |
31037485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 37271706 - 37271618
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||| |||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
37271706 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
37271618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 10408928 - 10409021
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg---taaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| ||||| |||| ||||||||| |||||||||||| |
|
|
| T |
10408928 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaaaaaattgtttttgatccctgcaaaat |
10409021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 224 - 279
Target Start/End: Original strand, 24443380 - 24443435
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24443380 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
24443435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 224 - 283
Target Start/End: Original strand, 38170514 - 38170573
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38170514 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
38170573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 1286682 - 1286776
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||| || |||||| |||||||||||| ||||||||||||||||||||||| || | ||||||||| || ||||||||||||| |
|
|
| T |
1286682 |
ggctaaaatatggtgttggtccctacaaatatgcctcgttttggttttagtccctgtaaaacaaatttgttgtttttgatctctgcaaaatattt |
1286776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 19565467 - 19565561
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |||| | |||||||||||||||||||||||||| |
|
|
| T |
19565467 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattt |
19565561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 28213373 - 28213431
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
28213373 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccatgtaa |
28213431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 30888160 - 30888250
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
30888160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtagaattttttttttgtttttggtccctgcaaaat |
30888250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 224 - 285
Target Start/End: Original strand, 4203456 - 4203517
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |||||| |
|
|
| T |
4203456 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtgcctataaaaa |
4203517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 224 - 285
Target Start/End: Complemental strand, 13990895 - 13990834
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
13990895 |
ggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaa |
13990834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 23381950 - 23382036
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||||| ||| |||||||||||| |||||||| |
|
|
| T |
23381950 |
ggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgtaaaaaaaaa----tgtttttggtccttgcaaaat |
23382036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 227 - 314
Target Start/End: Complemental strand, 27916761 - 27916671
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaa---ttttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |||||||||||||| ||||||||| |||| ||| |||||||||||||||||| |
|
|
| T |
27916761 |
taaaatatggttttattccctgcaaatatgcctcgttttggttttagtctctgtaaaaaaaaaaaagaattgattttggtccctgcaaaat |
27916671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 222 - 282
Target Start/End: Complemental strand, 29366951 - 29366891
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
29366951 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaa |
29366891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 32108808 - 32108895
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || |||| |||||| |||||||||||| ||| | |||||||||||||||||||| |
|
|
| T |
32108808 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttagttttaatccctgtaaaaa-aaattgttgtttttggtccctgcaaa |
32108895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 226 - 318
Target Start/End: Complemental strand, 35609635 - 35609544
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| ||||||||||||| ||| |||||| ||| | ||||||||| |||| ||||||||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctctaaaaa-aaattgttgtttttgatccccgcaaaatattt |
35609544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 224 - 311
Target Start/End: Complemental strand, 38555083 - 38554999
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaa |
311 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||| | ||||||||| ||||||||| |
|
|
| T |
38555083 |
ggctaaaatatggtttg-gtccctgcaaatatgcctcattttggttttagtccctctaaaa--aaattgttgtttttgatccctgcaa |
38554999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 40029141 - 40029228
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||| ||||||||||| |||||||||||| ||| |||||||| ||||||| ||||| |
|
|
| T |
40029141 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttaatccctgtaaaaaaaaa---ttgtttttcgtccctgtaaaat |
40029228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 224 - 283
Target Start/End: Original strand, 293828 - 293887
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |||||| |
|
|
| T |
293828 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccatgtaaa |
293887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 227 - 314
Target Start/End: Original strand, 15635379 - 15635465
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||| |||||||||| || |||||||||||||||||| |||| ||||| ||||||||||||||||||||| |
|
|
| T |
15635379 |
taaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccctggtaaaa-aaaataatgtttttggtccctgcaaaat |
15635465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 226 - 285
Target Start/End: Original strand, 16616370 - 16616429
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| || |||||| |
|
|
| T |
16616370 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtcactataaaaa |
16616429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 222 - 317
Target Start/End: Complemental strand, 20661313 - 20661218
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatatt |
317 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| || |||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
20661313 |
ttggctaaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaaatatt |
20661218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 224 - 309
Target Start/End: Complemental strand, 29151851 - 29151767
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgc |
309 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||||| ||| ||||||| | || ||||||||||||||||| |
|
|
| T |
29151851 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagttcctggtaaaaaaataa--ttgtttttggtccctgc |
29151767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 35166158 - 35166070
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||| ||| |||||||||||||||||| |||| |||| || ||||||||||||||||||| |
|
|
| T |
35166158 |
ggctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtccctggtaaaaaaaaa--ttatttttggtccctgcaaaat |
35166070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 224 - 279
Target Start/End: Original strand, 40764415 - 40764470
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40764415 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
40764470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 227 - 312
Target Start/End: Complemental strand, 45501 - 45415
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||| || ||| ||||| |||||| |||||||||||||||||||| |
|
|
| T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggttttaatctctgcaaaaaaaaaattgttgtttttggtccctgcaaa |
45415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 219 - 285
Target Start/End: Complemental strand, 3850604 - 3850538
Alignment:
| Q |
219 |
atgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||| ||| |||||||||||||||||| ||||| |
|
|
| T |
3850604 |
atgtaggctgaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgcaaaaa |
3850538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 5917126 - 5917220
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
5917126 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattt |
5917220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 290
Target Start/End: Original strand, 20683747 - 20683813
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaa |
290 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| || ||||| |||||||||||||||||| |||| |
|
|
| T |
20683747 |
ggctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtccctgtaaaaaaaaaa |
20683813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 224 - 285
Target Start/End: Complemental strand, 2032940 - 2032879
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||| ||||||||||||||| |||||||| |
|
|
| T |
2032940 |
ggctaaattatggttttagtccctgcaaatatgtctcgttttggttttagtccatgtaaaaa |
2032879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 224 - 293
Target Start/End: Original strand, 11799129 - 11799198
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattt |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||||||||||||| |||| ||||||| |
|
|
| T |
11799129 |
ggctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtccctgcgaaaaaaaaattt |
11799198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 224 - 281
Target Start/End: Original strand, 12144907 - 12144964
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta |
281 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
12144907 |
ggctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccctgta |
12144964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 224 - 315
Target Start/End: Complemental strand, 28871994 - 28871905
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctgcaaaata |
315 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||| ||||||||||||| ||||| ||||||| || ||||||||||| ||||||||||| |
|
|
| T |
28871994 |
ggctaaattatggttttggtccctgcaaatatgcctcgttttggttttagttcctgt--aaagaaatttattgtttttggt-cctgcaaaata |
28871905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 222 - 278
Target Start/End: Original strand, 15916284 - 15916340
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct |
278 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15916284 |
ttggctaaaagatggttttggtccctgcaaatatgtctcattttggttttagtccct |
15916340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 224 - 284
Target Start/End: Original strand, 19685017 - 19685077
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |||| |
|
|
| T |
19685017 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaa |
19685077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 224 - 276
Target Start/End: Complemental strand, 23382297 - 23382245
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtcc |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23382297 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
23382245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 224 - 272
Target Start/End: Complemental strand, 25561999 - 25561951
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25561999 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25561951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 227 - 279
Target Start/End: Original strand, 39379242 - 39379294
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39379242 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
39379294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 24782274 - 24782187
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||| ||||||||| | |||||||||||| ||||| |||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
24782274 |
ggctaaaatataattttagtcc-tacaaatatgcctcgttttgattttagtccctgtaaaaaataaa--ttgtttttggtccctgcaaaat |
24782187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 227 - 282
Target Start/End: Complemental strand, 28108159 - 28108104
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggttttagtccctgtaa |
28108104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 215 - 282
Target Start/End: Original strand, 29855604 - 29855671
Alignment:
| Q |
215 |
ttttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||| || ||||||||||| |||| |||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
29855604 |
ttttattttagctaaaatatgattttggtccttggaaatatgcctcattttggttttagtccctgtaa |
29855671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 223 - 282
Target Start/End: Original strand, 35609302 - 35609361
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| || ||||||||||||||||||||| |
|
|
| T |
35609302 |
tggctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctgtaa |
35609361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 222 - 285
Target Start/End: Complemental strand, 42596819 - 42596756
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| ||| |||| ||||||||||||||||||| |
|
|
| T |
42596819 |
ttggttaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgtaaaaa |
42596756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 219 - 285
Target Start/End: Complemental strand, 3851334 - 3851268
Alignment:
| Q |
219 |
atgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
3851334 |
atgtaggctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtccctgtaaaaa |
3851268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 231 - 314
Target Start/End: Original strand, 6118139 - 6118222
Alignment:
| Q |
231 |
atatggttttagtccctgcaaatatgcctcatttt-ggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||| ||||||||||||| ||||||| |||| ||||||||| |||||||||||| |
|
|
| T |
6118139 |
atatggttttagtctctgcaaatatgcctcgttttgggttttagtccctggtaaaaaaaaaa--ttgtttttgatccctgcaaaat |
6118222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 20690733 - 20690791
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||| |||||| |
|
|
| T |
20690733 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaa |
20690791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 312
Target Start/End: Original strand, 36973351 - 36973441
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||| ||| || |||||||| ||| ||||||||||||| | |||||||| | | |||||||||||||||||||| |
|
|
| T |
36973351 |
ttggctaaaatatggttttggtctctccaaatatgtctcgttttggttttagttcatgtaaaaaatatttgttgtttttggtccctgcaaa |
36973441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 38496420 - 38496509
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||| |||||||||| || ||||||| || |||||||||||||||| || |||| |||| |||||||||||||||||||||| |
|
|
| T |
38496420 |
ggctaaaatatagttttagtccttgtaaatatgtct-attttggttttagtccttggtaaaaaaaaaaattgtttttggtccctgcaaaat |
38496509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 224 - 308
Target Start/End: Original strand, 17070535 - 17070619
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctg |
308 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||| |||||||||||||||||| ||| || | |||||||||||||| |
|
|
| T |
17070535 |
ggctaaaatatggttttggtccctgcaaatatgtctc-gtttgattttagtccctgtaaaaaaaaatttatagtttttggtccctg |
17070619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 224 - 285
Target Start/End: Complemental strand, 17070863 - 17070802
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||| |||| ||||||| ||||||||||| |
|
|
| T |
17070863 |
ggctaaaatatggttttagtccctacaaatatgtctcgttttcgttttagaccctgtaaaaa |
17070802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 224 - 281
Target Start/End: Original strand, 26071291 - 26071348
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta |
281 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26071291 |
ggctaaaatatagtttcggtccctgcaaatatgtctcattttggttttagtccctgta |
26071348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 224 - 273
Target Start/End: Original strand, 35166911 - 35166960
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttag |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35166911 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttag |
35166960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 10830897 - 10830801
Alignment:
| Q |
224 |
ggctaaaatatggttttag-tccctgcaaatatgcctcattttggttttagtcc-ctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||| |||| | ||||||||||||||||| |||||||||||||||| |||||||| ||| | |||||||| |||| | |||||||||| |
|
|
| T |
10830897 |
ggctaaaatatgatttttggtccctgcaaatatgccttattttggttttagtcctttgtaaaaaaaaattgttgtttttagtccatacaaaatattt |
10830801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 227 - 282
Target Start/End: Complemental strand, 1287042 - 1286987
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| ||||||||||||||||| ||||||| |
|
|
| T |
1287042 |
taaaatatggttttggtccctgtaaatatgtctcattttggttttagttcctgtaa |
1286987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 5104002 - 5103951
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
274 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||||||||| |
|
|
| T |
5104002 |
tggctaaaatatggttttggttcctgcaaatatgtctcattttggttttagt |
5103951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 224 - 283
Target Start/End: Original strand, 5904008 - 5904067
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
5904008 |
ggctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagtccctgtaaa |
5904067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 223 - 282
Target Start/End: Original strand, 42553641 - 42553700
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |||||| |
|
|
| T |
42553641 |
tggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtctctgtaa |
42553700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 274
Target Start/End: Complemental strand, 18286741 - 18286691
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
274 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
18286741 |
ggctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagt |
18286691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 228 - 282
Target Start/End: Original strand, 32888691 - 32888745
Alignment:
| Q |
228 |
aaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||| |||||||||||||| |||| |||| |||||||||||||||| |
|
|
| T |
32888691 |
aaaatatggttttggtccctgcaaatattcctcgttttcgttttagtccctgtaa |
32888745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 226 - 280
Target Start/End: Complemental strand, 42207570 - 42207517
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt |
280 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||| ||||||||||||||||||| |
|
|
| T |
42207570 |
ctaaaatatggttttagtcc-tacaaatatgcctcgttttggttttagtccctgt |
42207517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 222 - 272
Target Start/End: Original strand, 42994066 - 42994116
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||| ||||| |
|
|
| T |
42994066 |
ttggctaaaatatggttttagtccctgcaaatatgactcgttttgatttta |
42994116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 285
Target Start/End: Original strand, 20416360 - 20416421
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||| |||||| ||||||| |
|
|
| T |
20416360 |
ggctaaaatatggttttcgtccctgcaaatatgtctcgctttggtttaagtcccggtaaaaa |
20416421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 237 - 280
Target Start/End: Complemental strand, 1286974 - 1286931
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctgt |
280 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1286974 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgt |
1286931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 221 - 314
Target Start/End: Complemental strand, 16616720 - 16616635
Alignment:
| Q |
221 |
gttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| || ||||||||| ||| ||||||||||||| | |||||| |
|
|
| T |
16616720 |
gttggctaaaatatggttttagtt-----aaatatgcctcattttggttttaatctctgtaaaaaaaaa---ttgtttttggtccttacaaaat |
16616635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 227 - 282
Target Start/End: Complemental strand, 26071613 - 26071558
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||| |||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
26071613 |
taaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccctgtaa |
26071558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 224 - 283
Target Start/End: Original strand, 36278081 - 36278140
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||| |||||||||| |||||| |
|
|
| T |
36278081 |
ggctaaaatatggttttgatccctgcaaatatgtttcattttagttttagtccatgtaaa |
36278140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 1105075 - 1105033
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1105075 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
1105033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 10830529 - 10830587
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||| || ||||||||||| ||||||||||||| ||||||| |
|
|
| T |
10830529 |
ggctaaaatatggttttggtctcttcaaatatgcctagttttggttttagttcctgtaa |
10830587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 227 - 285
Target Start/End: Original strand, 18286431 - 18286489
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||||||| |||||||||||| || ||||||||||| ||| |||||||| |
|
|
| T |
18286431 |
taaaatatggttttagttcctgcaaatatgtcttgttttggttttaatccttgtaaaaa |
18286489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 28871711 - 28871753
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28871711 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
28871753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 226 - 284
Target Start/End: Complemental strand, 38452394 - 38452336
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| ||||| ||||| || |||||||| |
|
|
| T |
38452394 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgattttaatctctgtaaaa |
38452336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 40038494 - 40038552
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||| ||||| ||| ||||| |
|
|
| T |
40038494 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttgattttaatccgtgtaa |
40038552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 227 - 284
Target Start/End: Complemental strand, 20418013 - 20417956
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
||||||||||||| |||| ||||||||||| ||| ||||| |||||||||| |||||| |
|
|
| T |
20418013 |
taaaatatggtttaagtctctgcaaatatgtctcgttttgattttagtccccgtaaaa |
20417956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 265 - 314
Target Start/End: Original strand, 25778825 - 25778873
Alignment:
| Q |
265 |
tggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||| ||||||||||||||| |
|
|
| T |
25778825 |
tggttttagtccctgtaaaaa-aaaatattgtttctggtccctgcaaaat |
25778873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 224 - 283
Target Start/End: Original strand, 38554751 - 38554808
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||| |||||||||||||| ||||||| |
|
|
| T |
38554751 |
ggctaaaatatggttttgatccctgcaaatat--ctcgttttggttttagtctctgtaaa |
38554808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 225 - 283
Target Start/End: Complemental strand, 9588611 - 9588552
Alignment:
| Q |
225 |
gctaaaatatggttttag-tccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||| |||| | |||||||||||||| ||| ||||||||||||||| |||||| |
|
|
| T |
9588611 |
gctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtccatgtaaa |
9588552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 1381538 - 1381496
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
1381538 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
1381496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 2636742 - 2636784
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
2636742 |
ttttggtccctgcaaatatgccttattttggttttggtccctg |
2636784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 4736469 - 4736427
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
4736469 |
ttttggtctctgcaaatatgcctcattttggtttttgtccctg |
4736427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 6912571 - 6912613
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
6912571 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
6912613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 19565758 - 19565716
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
19565758 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
19565716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 242 - 312
Target Start/End: Original strand, 22394140 - 22394210
Alignment:
| Q |
242 |
gtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| | ||||| |||| ||||||||||| |
|
|
| T |
22394140 |
gtccctgcaaatatctgacattttggttttagtccctgtaaaaatatttttttggttttagtccctgcaaa |
22394210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #172
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 24443453 - 24443495
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
24443453 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
24443495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #173
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 271
Target Start/End: Original strand, 32108880 - 32108914
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggtttt |
271 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
32108880 |
ttttggtccctgcaaatatgcctcattttggtttt |
32108914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #174
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 35876761 - 35876803
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
35876761 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
35876803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #175
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 35928137 - 35928179
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
35928137 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
35928179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #176
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 37271633 - 37271591
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
37271633 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
37271591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #177
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 40764488 - 40764530
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
40764488 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
40764530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #178
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 312
Target Start/End: Original strand, 4122593 - 4122663
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||| |||| ||| |||| ||||||||||| |
|
|
| T |
4122593 |
tagtccctgcaaatatttgacattttgattttagtccctgtaaaaaaaaaa--ttgattttagtccctgcaaa |
4122663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #179
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 285
Target Start/End: Original strand, 10461359 - 10461404
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||| |||||||| |
|
|
| T |
10461359 |
tagtccctgcaaatatccgtcattttggttttagtctttgtaaaaa |
10461404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #180
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 226 - 271
Target Start/End: Complemental strand, 12145181 - 12145136
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggtttt |
271 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| ||||| |||| |
|
|
| T |
12145181 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
12145136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #181
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 226 - 275
Target Start/End: Complemental strand, 20691094 - 20691045
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
275 |
Q |
| |
|
|||||||||| |||| || |||||||||||| ||| |||||||||||||| |
|
|
| T |
20691094 |
ctaaaatatgattttggttcctgcaaatatggctcgttttggttttagtc |
20691045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #182
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 285
Target Start/End: Original strand, 22540097 - 22540158
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||| || | ||||| ||||||||| |||||||| |||||| | |||||||||| |
|
|
| T |
22540097 |
ggctaaaatatgattatggtccccgcaaatatgtctcatttttgttttaattcctgtaaaaa |
22540158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #183
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 285
Target Start/End: Original strand, 24490858 - 24490903
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24490858 |
tagtccctgcaaatatctgacattttggttttagtccctgtaaaaa |
24490903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #184
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 252
Target Start/End: Original strand, 35165936 - 35165965
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaa |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35165936 |
tggctaaaatatggttttagtccctgcaaa |
35165965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #185
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 278
Target Start/End: Original strand, 36973426 - 36973467
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccct |
278 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
36973426 |
ttttggtccctgcaaatatgcctcattttgattttggtccct |
36973467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #186
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 265 - 314
Target Start/End: Original strand, 37090428 - 37090476
Alignment:
| Q |
265 |
tggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||| ||||||||||||| |
|
|
| T |
37090428 |
tggttttagtccctgtaaaaa-aaaaaattgttttttgtccctgcaaaat |
37090476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #187
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 312
Target Start/End: Complemental strand, 3598762 - 3598710
Alignment:
| Q |
260 |
cattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||| |||| ||||||||||| |
|
|
| T |
3598762 |
cattttggttttagtccctgtaaaaatatttttttggttttagtccctgcaaa |
3598710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #188
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 312
Target Start/End: Complemental strand, 14869041 - 14868969
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||| | ||||| |||| ||||||||||| |
|
|
| T |
14869041 |
tagtccctgcaaatatctgacattttggttttagtcactgtaaaaatatttttttggttttagtccctgcaaa |
14868969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #189
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 312
Target Start/End: Complemental strand, 15969779 - 15969727
Alignment:
| Q |
260 |
cattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||| |||||||||||||||||| || ||||| |||| ||||||||||| |
|
|
| T |
15969779 |
cattttgattttagtccctgtaaaaataattttttgattttagtccctgcaaa |
15969727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #190
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 225 - 281
Target Start/End: Complemental strand, 22551318 - 22551262
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta |
281 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| | |||||||||||||| ||||| |
|
|
| T |
22551318 |
gctaaaatatggttttagtctctgtaaatatgttttgttttggttttagtctctgta |
22551262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #191
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 31602143 - 31602236
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcatt----ttggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| || || |||||||| |||| | |||||| |||||| | |||||||||||||||||| |
|
|
| T |
31602143 |
ggctaaaatatagttttgatccctgcaaatatgcatcgttttggttggtttttgtccatataaaaaaaaaattgtagtttttggtccctgcaaa |
31602236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #192
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 312
Target Start/End: Original strand, 43196935 - 43196987
Alignment:
| Q |
260 |
cattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||| |||| ||||||||||| |
|
|
| T |
43196935 |
cattttggttttagtccctgtaaaaatatttttttggttttagtccctgcaaa |
43196987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 91; Significance: 4e-44; HSPs: 226)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 40301975 - 40302069
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40301975 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
40302069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 223 - 318
Target Start/End: Original strand, 12835324 - 12835419
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
12835324 |
tggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtctctgcaaaatattt |
12835419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 225 - 314
Target Start/End: Complemental strand, 3838263 - 3838174
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3838263 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
3838174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 227 - 314
Target Start/End: Original strand, 42358702 - 42358789
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42358702 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttgattttggtccctgcaaaat |
42358789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 215 - 314
Target Start/End: Complemental strand, 40302348 - 40302249
Alignment:
| Q |
215 |
ttttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
40302348 |
ttttatataggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgtaaacaaaaaattttgtttttggtccctgcaaaat |
40302249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 11713845 - 11713755
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
11713845 |
ggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaataattttgtttttggtccctgcaaaat |
11713755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 32476095 - 32476189
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
32476095 |
ggctaaaatatggttttgatccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
32476189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 16523325 - 16523231
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| ||| | |||||||||||||| ||||||||||| |
|
|
| T |
16523325 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatattt |
16523231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 25705085 - 25705179
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
25705085 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
25705179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 44985984 - 44985894
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
44985984 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaaaaataaaattttgtttttggtctctgcaaaat |
44985894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 224 - 317
Target Start/End: Complemental strand, 2481557 - 2481464
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatatt |
317 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| || | ||||||||||||||||||||||||| |
|
|
| T |
2481557 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatatt |
2481464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 223 - 318
Target Start/End: Complemental strand, 146691 - 146596
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || |||||||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
146691 |
tggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
146596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 222 - 313
Target Start/End: Original strand, 11713483 - 11713574
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| | |||||||||||||| ||||| |||| |
|
|
| T |
11713483 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaacaattttgtttttggcccctgtaaaa |
11713574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 223 - 318
Target Start/End: Complemental strand, 20131682 - 20131587
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||||||||| |
|
|
| T |
20131682 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattt |
20131587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 227 - 314
Target Start/End: Complemental strand, 25954423 - 25954336
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
25954423 |
taaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgtaaaataaaaattttgtttttggtccctgcaaaat |
25954336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 3837933 - 3838027
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||| |||| |||||||||||||||||||| ||||||||||||||||| |||||||| |||| |
|
|
| T |
3837933 |
ggctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtccctgtaaaaaggaaattttgtttttggtctctgcaaaaaattt |
3838027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 10665294 - 10665204
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||| || ||||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10665294 |
ggctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagttcctgtaaaaagaaaattttgtttttggtccctacaaaat |
10665204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 19183782 - 19183872
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |||| ||||||||||||||| |||||||||||| |
|
|
| T |
19183782 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaattttgtttttgatccctgcaaaat |
19183872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 26814229 - 26814139
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||| ||||||||| ||||||||||||| |
|
|
| T |
26814229 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgttttttgtccctgcaaaat |
26814139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 37271739 - 37271829
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||| |||||||||||||| |||||||| |
|
|
| T |
37271739 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccttgcaaaat |
37271829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 40125289 - 40125195
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||| ||||||||||||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
40125289 |
ggctaaaatatgattttggtccctgcaaatatgcctcatttttgttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattt |
40125195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 43592046 - 43592136
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| || | |||||||||||||| |||||||| |
|
|
| T |
43592046 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaataatttgtttttggtccttgcaaaat |
43592136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 43788858 - 43788948
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| || |||| |||| ||||||||||||||||||||||| |
|
|
| T |
43788858 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttggtaaaaaaaaaatttgtttttggtccctgcaaaat |
43788948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 222 - 314
Target Start/End: Original strand, 1497608 - 1497699
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||| |||| |||||||||||||| |||||||| |
|
|
| T |
1497608 |
ttggctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgtaaaaa-aaaaatttgtttttggtccttgcaaaat |
1497699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 4423895 - 4423983
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| || | |||||||||||||||||||| |
|
|
| T |
4423895 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
4423983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 222 - 314
Target Start/End: Original strand, 5334749 - 5334841
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||||| |
|
|
| T |
5334749 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaat |
5334841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 19184151 - 19184062
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
19184151 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
19184062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 22881613 - 22881700
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
22881613 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
22881700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 24483891 - 24483804
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| || ||||||||||||||||||| |
|
|
| T |
24483891 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa---ttatttttggtccctgcaaaat |
24483804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 215 - 318
Target Start/End: Complemental strand, 30215880 - 30215776
Alignment:
| Q |
215 |
ttttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
|||||| | ||||||||||||||||| |||||||||||||| | | |||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
30215880 |
ttttatataggctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccctgtaaaaaaaaaattgttgtttttggtccctgcaaaa |
30215781 |
T |
|
| Q |
314 |
tattt |
318 |
Q |
| |
|
||||| |
|
|
| T |
30215780 |
tattt |
30215776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 222 - 313
Target Start/End: Complemental strand, 33733243 - 33733154
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |||||| |||| ||||||||||||||||||||| |
|
|
| T |
33733243 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctataaaaaaaaaa--ttgtttttggtccctgcaaaa |
33733154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 37272102 - 37272013
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
37272102 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
37272013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 38731829 - 38731916
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
38731829 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
38731916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 38980253 - 38980164
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
38980253 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
38980164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 226 - 314
Target Start/End: Original strand, 41791020 - 41791107
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |||||||||||| ||||||||| |
|
|
| T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgtaaaaa-aaaaaattgtttttggtctctgcaaaat |
41791107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 226 - 313
Target Start/End: Original strand, 44985623 - 44985709
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || | |||||||||||||| ||||||| |
|
|
| T |
44985623 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaa-aagaatttgtttttggtccatgcaaaa |
44985709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 14003742 - 14003648
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| | | |||||||||||||||||||||||||| |
|
|
| T |
14003742 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaatattttgttgtttttggtccctgcaaaatattt |
14003648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 15842823 - 15842729
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| | | |||||||||||||||||||||||||| |
|
|
| T |
15842823 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattt |
15842729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 16673771 - 16673677
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||| ||||| || | |||||||||||||||||||||||||| |
|
|
| T |
16673771 |
ggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattt |
16673677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 29859872 - 29859778
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
29859872 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaatttttgttgtttttggtccctgcaaaatattt |
29859778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 31226077 - 31225987
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||| |||||||||||| |||| |||||||| ||||||||||||| |
|
|
| T |
31226077 |
ggctaaaatatggttttactccctgcaaatatgcctcgttttggttttactccctgtaaaaaaaaaaaattgttttttgtccctgcaaaat |
31225987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 31326252 - 31326162
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||| |||| |||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
31326252 |
ggctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtccctgtaaaataaaatttttgtttttggtccctgcaaaat |
31326162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 37910756 - 37910849
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||| ||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
37910756 |
ggctaaaatatggttttgatccttgcaaatatgcctcattttagttttagtccctgtaaaaa-aaattgttgtttttggtccctgcaaaatattt |
37910849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 43789192 - 43789102
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| || |||||||||||||||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
43789192 |
ggctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaat |
43789102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 44073807 - 44073717
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
44073807 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaat |
44073717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 222 - 313
Target Start/End: Complemental strand, 5790901 - 5790811
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg-taaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |||||| |||| ||||||||||||||||||||| |
|
|
| T |
5790901 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgataaaaaaaaaa--ttgtttttggtccctgcaaaa |
5790811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 9195206 - 9195120
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||| |||||||||||||| |||||| |
|
|
| T |
9195206 |
ggctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccctgtaaaa--aaaaatttgtttttggtccttgcaaa |
9195120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 224 - 316
Target Start/End: Original strand, 31644841 - 31644934
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctgcaaaatat |
316 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||| ||||||||| |||||| |||||||| ||||||||||||||| |
|
|
| T |
31644841 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaaaaaaaaaattgttgtttttagtccctgcaaaatat |
31644934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 33732862 - 33732948
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || ||||||||| |||||||||||| |
|
|
| T |
33732862 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaa----ttgtttttgatccctgcaaaat |
33732948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 43597154 - 43597240
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
43597154 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa----tgtttttggtccctgcaaaat |
43597240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 7814737 - 7814650
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| ||| |||||||||||||| ||||||| |
|
|
| T |
7814737 |
ggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgtcaaaaaaaa---ttgtttttggtccccgcaaaat |
7814650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 17541382 - 17541471
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
17541382 |
ggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
17541471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 18113089 - 18113177
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| || | |||||||||||||||||||| |
|
|
| T |
18113089 |
ggctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
18113177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 25705449 - 25705361
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
25705449 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
25705361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 31225715 - 31225803
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||||| ||||||| |||||||||| || |||||||||||| |||||||||| |
|
|
| T |
31225715 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagttcctgtaaaaaaaatattttgtttttgatccctgcaaa |
31225803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 41694005 - 41693913
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |||| ||||||||||||| || ||||| |
|
|
| T |
41694005 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaagaaaaaaattgtttttggtccatgtaaaat |
41693913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 3671003 - 3671091
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||| ||||||||||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
3671003 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccctgtgaaaaaaaaa--ttgtttttggtccctgcaaaat |
3671091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 223 - 314
Target Start/End: Original strand, 5790557 - 5790648
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| ||| || |||||||||||||||||||||||| |
|
|
| T |
5790557 |
tggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctggtaaattaattttttgtttttggtccctgcaaaat |
5790648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 225 - 314
Target Start/End: Original strand, 24483401 - 24483487
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
24483401 |
gctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
24483487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 224 - 310
Target Start/End: Original strand, 27310876 - 27310959
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgca |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
27310876 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgg-tttagtccctgtaaaaaaaaaa--ttgtttttggtccctgca |
27310959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 29865511 - 29865423
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| || ||||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
29865511 |
ggctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctgtaaaa--taaaatttgtttttggtccctgcaaaat |
29865423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 36622250 - 36622334
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
36622250 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaa----tgtttttggtccctgcaaa |
36622334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 223 - 318
Target Start/End: Complemental strand, 36806897 - 36806802
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| ||| | || ||||||||||||| ||||||||| |
|
|
| T |
36806897 |
tggccaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttatttttggtccctgtaaaatattt |
36806802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 24358616 - 24358710
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| | |||||||||||||||||||||||||| |
|
|
| T |
24358616 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaaatattt |
24358710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 222 - 314
Target Start/End: Original strand, 26813864 - 26813955
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||| |||| |||||||||||| ||||||||| |
|
|
| T |
26813864 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtctctgcaaaat |
26813955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 222 - 312
Target Start/End: Original strand, 29859485 - 29859575
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
29859485 |
ttggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
29859575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 222 - 308
Target Start/End: Original strand, 31325918 - 31326004
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctg |
308 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| || |||| |||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
31325918 |
ttggctaaaatatggttctagtccctgcaaatatgcatcgttttagttttagtccctgtaaaataaaaatttcgtttttggtccctg |
31326004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 33575752 - 33575846
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||||||| ||||| || | |||||||||||||||||||||||||| |
|
|
| T |
33575752 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattt |
33575846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 226 - 314
Target Start/End: Complemental strand, 36622582 - 36622496
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||||| |||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
36622582 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtttctgtaaaa--aaaaatttgtttttggtccctgcaaaat |
36622496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 225 - 318
Target Start/End: Complemental strand, 42696202 - 42696109
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||||||||| |||||||| || | ||||||||| |||||||||||||||| |
|
|
| T |
42696202 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccatgtaaaaaaaatttgttgtttttgatccctgcaaaatattt |
42696109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 14003409 - 14003497
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| || |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
14003409 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
14003497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 20131317 - 20131405
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
20131317 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
20131405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 20658061 - 20658148
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |||||||| ||||||||||||| |
|
|
| T |
20658061 |
ggctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaaaaaaaaa---ttgtttttagtccctgcaaaat |
20658148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 23732328 - 23732241
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||| |||||| ||||||||||||||||| ||| | |||||||||||||||||||| |
|
|
| T |
23732328 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttgg-tttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaa |
23732241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 23989838 - 23989925
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||| || |||||| ||| |||||||||||||||||||||| |
|
|
| T |
23989838 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcactataaaaaaaaa---ttgtttttggtccctgcaaaat |
23989925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 26707873 - 26707960
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| | || |||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
26707873 |
ggctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
26707960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 30215422 - 30215510
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| || |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
30215422 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
30215510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 308
Target Start/End: Original strand, 41693674 - 41693757
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctg |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
41693674 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaaaaa-aaaaaattgtttttggtccctg |
41693757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 43597499 - 43597412
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||| ||| |||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
43597499 |
ggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
43597412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 223 - 294
Target Start/End: Complemental strand, 8046649 - 8046579
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatttt |
294 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
8046649 |
tggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaaaaa-aaaatttt |
8046579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 223 - 314
Target Start/End: Complemental strand, 10375070 - 10374984
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||| |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
10375070 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccctgtaaaaaaaa-----tgtttttggtccctgcaaaat |
10374984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 10664984 - 10665072
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||| | |||||||||||||||| |||| ||||||||||||| |||||||| |
|
|
| T |
10664984 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccctgtaaaaaaaaaa--ttgtttttggtccttgcaaaat |
10665072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 227 - 314
Target Start/End: Complemental strand, 17912808 - 17912722
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||| ||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtctctggtaaaa-aaaaatttgtttttggtccctgcaaaat |
17912722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 38639412 - 38639500
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
38639412 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctggtaaaaaaaaa--ttgtttttggtccctgcaaaat |
38639500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 310
Target Start/End: Original strand, 8046329 - 8046414
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgca |
310 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| || |||| |||||| |||||||| |
|
|
| T |
8046329 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgtaaaaa-aattttttttttttgatccctgca |
8046414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 222 - 308
Target Start/End: Original strand, 27109071 - 27109157
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctg |
308 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||| ||||||||||||||||| |||||| ||| | ||| |||||||||||| |
|
|
| T |
27109071 |
ttggctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtccctataaaaaaaaattgttggttttggtccctg |
27109157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 308
Target Start/End: Complemental strand, 27311069 - 27310988
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctg |
308 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||| ||| |||||||||||||||| |
|
|
| T |
27311069 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctataaaaaaaaa---ttgtttttggtccctg |
27310988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 230 - 312
Target Start/End: Original strand, 35155298 - 35155380
Alignment:
| Q |
230 |
aatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||||||| || ||||| ||| | |||||||||||||||||||| |
|
|
| T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgcaaaaaaaaattgttgtttttggtccctgcaaa |
35155380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 39367760 - 39367666
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||| || |||||| |||||||| | ||||||||||||||| ||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
39367760 |
ggctaaaatatggtcttgatccctgtaaatatgctttattttggttttagtctctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
39367666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 229 - 318
Target Start/End: Complemental strand, 4794468 - 4794380
Alignment:
| Q |
229 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||| |||||| |||||||| ||| |||||||||||||| ||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
4794468 |
aaatatggttttggtccctacaaatatgtctcgttttggttttagtctctgtaaaaa-aaattgttgtttttggtccctgcaaaatattt |
4794380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 225 - 290
Target Start/End: Original strand, 10374775 - 10374840
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaa |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |||| |
|
|
| T |
10374775 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaaa |
10374840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 16900206 - 16900120
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| ||||| || ||||| ||||||||||| |
|
|
| T |
16900206 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaa--aaaatattttttttagtccctgcaaa |
16900120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 16993597 - 16993511
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| ||||| || ||||| ||||||||||| |
|
|
| T |
16993597 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaa--aaaatattttttttagtccctgcaaa |
16993511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 26239160 - 26239071
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg-taaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||| ||||| |||| |||||||||||||| |||||| |
|
|
| T |
26239160 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgcaaaaaaaaaaaatttgtttttggtccttgcaaa |
26239071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 32691313 - 32691399
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||| |||||||||||| |||| ||||||||||||| |||||| |
|
|
| T |
32691313 |
ggctaaaatatggttttagtttctgcaaatatgcctcgttttggttttaatccctgtaaaaaaaaaa--ttgtttttggtccttgcaaa |
32691399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 221 - 282
Target Start/End: Original strand, 40124963 - 40125024
Alignment:
| Q |
221 |
gttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40124963 |
gttggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttcctgtaa |
40125024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 222 - 290
Target Start/End: Complemental strand, 3671194 - 3671126
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaa |
290 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |||| |
|
|
| T |
3671194 |
ttggctcaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtgaaaacaaaa |
3671126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 222 - 318
Target Start/End: Complemental strand, 7121310 - 7121216
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||| ||||||| |||||||||| |||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
7121310 |
ttggctaaaatatggttttagtcc-tgtaaatatgtttcattttagttttagtccttgtaaaaa-aaattgttgtttttggtccctgcaaaatattt |
7121216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 16673411 - 16673499
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| || || | | |||||||||||||||||||| |
|
|
| T |
16673411 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgcaagaaaattttgttgtttttggtccctgcaaa |
16673499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 17541776 - 17541687
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||||||| | ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
17541776 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
17541687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 24358945 - 24358857
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||| | | |||||||||||||||||||| |
|
|
| T |
24358945 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
24358857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 225 - 285
Target Start/End: Original strand, 29865222 - 29865282
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaa |
29865282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 310
Target Start/End: Complemental strand, 43710708 - 43710625
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgca |
310 |
Q |
| |
|
|||||||||||| |||||| || |||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
43710708 |
ggctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgca |
43710625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 2265397 - 2265309
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| ||| |||||||||||||||||||||||| |||| ||||||||| ||| |||||||| |
|
|
| T |
2265397 |
ggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaaa--ttgtttttgatccttgcaaaat |
2265309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 227 - 312
Target Start/End: Original strand, 16968555 - 16968637
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| ||| ||||||||| |||||||||| |
|
|
| T |
16968555 |
taaaatatggttttagtccctacaaatatgccttgttttggttttagtccctgtaaaaaaaaa---ttgtttttgctccctgcaaa |
16968637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 224 - 311
Target Start/End: Original strand, 25954115 - 25954201
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaa |
311 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || ||||||||||||||| |||||||| |||| ||||||||||||||||||| |
|
|
| T |
25954115 |
ggctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtccttgtaaaaa-aaaaaattgtttttggtccctgcaa |
25954201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 227 - 312
Target Start/End: Original strand, 26238816 - 26238898
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||| |||||||||||||||||| ||| |||| ||||||||||||||| |
|
|
| T |
26238816 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaaa---ttgtgtttggtccctgcaaa |
26238898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 226 - 312
Target Start/End: Original strand, 146328 - 146414
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
146328 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaattttttgttgtttttggtccctgcaaa |
146414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 222 - 312
Target Start/End: Complemental strand, 4042892 - 4042802
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||||| || ||||| ||| | ||||||||||||||| |||| |
|
|
| T |
4042892 |
ttggctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagtccttgcaaaaaaaaattgttgtttttggtccctacaaa |
4042802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 11788416 - 11788358
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
11788416 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
11788358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 13215060 - 13215154
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
13215060 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaaatattt |
13215154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 16522991 - 16523049
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
16522991 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
16523049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 20658409 - 20658316
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttg--gttttagtccctgt-aaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| ||||| ||||||||||||| ||||| |||| ||||||||||||||||||||||| |
|
|
| T |
20658409 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttttagtccctgtaaaaaaaaaaaatttgtttttggtccctgcaaaat |
20658316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 36815488 - 36815582
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| | ||| ||||||| ||| |||||||||||||||||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
36815488 |
ggctaaaatatggttttgccctctgtaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattt |
36815582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 40786460 - 40786549
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| ||| |||||||||||||||||||||||| ||||| |||||||| || ||||||||| |
|
|
| T |
40786460 |
ggctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtccctgtaaaaa-aaaatattgtttttcatctctgcaaaat |
40786549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 43592380 - 43592291
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||| ||||||||| ||||||||| |||||||| |||| |||||||||||||| ||| |||| |
|
|
| T |
43592380 |
ggctaaaatatgattttagtccctgctaatatgtctcattttgattttagtccttgtaaaaa-aaaaatttgtttttggtccgtgcgaaat |
43592291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 224 - 285
Target Start/End: Original strand, 3172020 - 3172081
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3172020 |
ggctaaaatatgattttggtccctgcaaatatgcctcattttggttttagtccatgtaaaaa |
3172081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 223 - 284
Target Start/End: Complemental strand, 5335041 - 5334980
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
5335041 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaa |
5334980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 227 - 314
Target Start/End: Original strand, 17912452 - 17912538
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||| |||||||||||||| || ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
17912452 |
taaaatatgattttagtccctgcaaatatgtctcgttttggttttagtctctggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
17912538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 4794130 - 4794218
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||||||| || || || | |||||||||||||||||||| |
|
|
| T |
4794130 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgcaacaaaaatttgttgtttttggtccctgcaaa |
4794218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 227 - 316
Target Start/End: Original strand, 5006610 - 5006701
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt--ttgtttttggtccctgcaaaatat |
316 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||| ||||||||||||| ||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
5006610 |
taaaatatggttttggtctctgcaaatatatctcgttttggttttagtttctgtaaaaaaaaaatttgttgtttttggtccctgcaaaatat |
5006701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 222 - 314
Target Start/End: Original strand, 23732037 - 23732129
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||| ||||||||||||||| |||||||| | | |||||||||||||||||||||| |
|
|
| T |
23732037 |
ttggctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccatgtaaaaaaattttgttgtttttggtccctgcaaaat |
23732129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 244 - 312
Target Start/End: Complemental strand, 26708184 - 26708116
Alignment:
| Q |
244 |
ccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
26708184 |
ccctgcaaatacgcctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaa |
26708116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 226 - 318
Target Start/End: Complemental strand, 29182440 - 29182349
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||| |||| |||||||||||||| ||| ||||||||||||| ||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
29182440 |
ctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtttctgtaaaaa-aaattgttgtttttggtccctgcaaaatattt |
29182349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 222 - 282
Target Start/End: Original strand, 34317796 - 34317856
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34317796 |
ttggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
34317856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 224 - 284
Target Start/End: Original strand, 44559062 - 44559122
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
44559062 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaa |
44559122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 224 - 283
Target Start/End: Complemental strand, 4424185 - 4424126
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
4424185 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
4424126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 224 - 283
Target Start/End: Complemental strand, 10671941 - 10671882
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |||||| |
|
|
| T |
10671941 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaaa |
10671882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 225 - 284
Target Start/End: Complemental strand, 20939324 - 20939265
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
20939324 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaa |
20939265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 222 - 285
Target Start/End: Complemental strand, 41791314 - 41791251
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||||| |||| ||||||||| |
|
|
| T |
41791314 |
ttggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttaagtctctgtaaaaa |
41791251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 305
Target Start/End: Original strand, 7814246 - 7814325
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtcc |
305 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||| |||||||||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
7814246 |
ggctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccctggtaaaaaaaaa--ttgtttttggtcc |
7814325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 223 - 281
Target Start/End: Original strand, 9195053 - 9195111
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||| |
|
|
| T |
9195053 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
9195111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 157 - 223
Target Start/End: Original strand, 12820830 - 12820896
Alignment:
| Q |
157 |
tcatgaagttgtgtattttgaaaaggacgatcaactttcaacctaagtaacaacgaagttttatgtt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |||||||||||| |||| || ||||| |
|
|
| T |
12820830 |
tcatgaagttgtgtattttgaaaaggacaatcaactttcatcctaagtaacaatgaagcttcatgtt |
12820896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 242 - 314
Target Start/End: Complemental strand, 22881950 - 22881881
Alignment:
| Q |
242 |
gtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
22881950 |
gtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
22881881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 223 - 312
Target Start/End: Original strand, 38979888 - 38979978
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatat-gcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |||| |||| ||||||||||| |||||||| |
|
|
| T |
38979888 |
tggctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtacctgcaaa |
38979978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 43672318 - 43672224
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| | |||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
43672318 |
ggctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtccctgtaaaaattttttattgtttttggtccctgcaaaatattt |
43672224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 222 - 314
Target Start/End: Original strand, 43710379 - 43710468
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||| |||||||| ||||||||||| |||||||| ||| ||||||||||||||||| |||||| |||| ||||||||||||||||||||| |
|
|
| T |
43710379 |
ttggttaaaatataattttagtcccttcaaatatgtctcgttttggttttagtccctataaaaaaaaaa---tgtttttggtccctgcaaaat |
43710468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 227 - 284
Target Start/End: Original strand, 15842464 - 15842521
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
15842464 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaa |
15842521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 226 - 282
Target Start/End: Original strand, 1137983 - 1138039
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgtaa |
1138039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 226 - 314
Target Start/End: Complemental strand, 1497943 - 1497855
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||| |||||||||||||||||| | || |||||||||||||||||||||||| |
|
|
| T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtccctgcagaactttttttttgtttttggtccctgcaaaat |
1497855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 10671630 - 10671718
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
10671630 |
ggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctgtaattttatttttttgtttttggtccctgcaaa |
10671718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 224 - 284
Target Start/End: Complemental strand, 37911120 - 37911060
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| || ||||||||||| ||||||||||| |
|
|
| T |
37911120 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccctgtaaaa |
37911060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 224 - 284
Target Start/End: Original strand, 41451837 - 41451897
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |||| |
|
|
| T |
41451837 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaa |
41451897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 222 - 278
Target Start/End: Original strand, 42695866 - 42695922
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct |
278 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
42695866 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
42695922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 14393128 - 14393041
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| ||| ||| |||||||||||| ||| ||||||||||||||| |||||||| |||| |||||||| ||||||||||||| |
|
|
| T |
14393128 |
ggctaaaatatgattt-agttcctgcaaatatgtctcgttttggttttagtccatgtaaaaaaaaaa--ttgttttttgtccctgcaaaat |
14393041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 219 - 282
Target Start/End: Complemental strand, 31909483 - 31909421
Alignment:
| Q |
219 |
atgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
31909483 |
atgtaggctaaaatatggttttggtccctgcaaatatgcctc-ttttggttttagtctctgtaa |
31909421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 224 - 279
Target Start/End: Complemental strand, 33576117 - 33576062
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
33576117 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33576062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 44994061 - 44993970
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt-aaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| |||| ||||||||| |||| ||||| |||| ||||||||||||| || ||||| |
|
|
| T |
44994061 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagtctctgtaaaaaaaaaaaaattgtttttggtccttgtaaaat |
44993970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 17302143 - 17302085
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
17302143 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgtaa |
17302085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 226 - 284
Target Start/End: Complemental strand, 44559407 - 44559349
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| |||||||||||||| |||||||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaaaa |
44559349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 49 - 130
Target Start/End: Original strand, 12816286 - 12816367
Alignment:
| Q |
49 |
cttgaacaaagcatttttcaactccaaagaaccccatctattaaagctctttttactaatagcttcatcatttgcaagccac |
130 |
Q |
| |
|
||||||||| |||||||| || ||||||| |||| |||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
12816286 |
cttgaacaaggcattttttaatgccaaagaccccctactattaaagctctttttaatgttagcttcatcatttgcaagccac |
12816367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 227 - 314
Target Start/End: Original strand, 14392791 - 14392875
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| |||| |||||| ||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
14392791 |
taaaatatggttttagtcattgtaaatatgcctcgttttagttttaatccttgtaaa---aaaaatttgtttttggtccctgcaaaat |
14392875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 222 - 283
Target Start/End: Complemental strand, 18113456 - 18113395
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||| || ||||||||||| |||||||||| |
|
|
| T |
18113456 |
ttggctaaaatatggttttggtccctacaaatatgcttcgttttggttttaatccctgtaaa |
18113395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 227 - 314
Target Start/End: Complemental strand, 23990193 - 23990109
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| |||||||||||||| | ||||||| ||| ||||||||| ||||| |||||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtcaccgtaaaaaaaaa---ttgtttttgatccctacaaaat |
23990109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 224 - 276
Target Start/End: Original strand, 4042610 - 4042662
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtcc |
276 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
4042610 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
4042662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 225 - 308
Target Start/End: Original strand, 4842865 - 4842946
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctg |
308 |
Q |
| |
|
|||||||||||||||| | |||||||||||| ||| ||||||||||||||||| ||||| ||| | |||||||||||||||| |
|
|
| T |
4842865 |
gctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagtccctataaaa--aaattgttgtttttggtccctg |
4842946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 222 - 282
Target Start/End: Complemental strand, 34318085 - 34318025
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
34318085 |
ttggctaaaatatggttttggtccctacaaatatgcctcgttttgattttagtccttgtaa |
34318025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 222 - 282
Target Start/End: Complemental strand, 34964161 - 34964101
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||| ||||||| |||||||| |
|
|
| T |
34964161 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagcccctgtaa |
34964101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 227 - 313
Target Start/End: Complemental strand, 38732130 - 38732047
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
|||||| || |||||||||| ||||||||| ||| ||||||||||| |||||||||||| ||| || |||||||||||||||||| |
|
|
| T |
38732130 |
taaaatttgattttagtcccagcaaatatggctcgttttggttttaatccctgtaaaaaaaaa---ttatttttggtccctgcaaaa |
38732047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 35685972 - 35686066
Alignment:
| Q |
224 |
ggctaaaatatggttttag-tccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||| |||| | | |||||||||||| || |||| ||||||||||||||||||| ||| | |||||||| ||||||||||||||||| |
|
|
| T |
35685972 |
ggctaaaatatgatttttggttcctgcaaatatggttcgttttagttttagtccctgtaaaaa-aaattattgtttttagtccctgcaaaatattt |
35686066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 1138359 - 1138301
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| |||| |||||||||||||||| |
|
|
| T |
1138359 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctgtaa |
1138301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 3172532 - 3172474
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||| |||| |||| |||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
3172532 |
ggctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagtccatgtaa |
3172474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 227 - 293
Target Start/End: Original strand, 19831511 - 19831577
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattt |
293 |
Q |
| |
|
|||||||||||||||||| |||||||||| || ||||||||||||| |||||||||| ||||||| |
|
|
| T |
19831511 |
taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctgtaaaaaaaaaattt |
19831577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 36815835 - 36815777
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
36815835 |
ggctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcctgtaa |
36815777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 37228733 - 37228791
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || |||||||||||||| |||||| |
|
|
| T |
37228733 |
ggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagtctctgtaa |
37228791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 43671934 - 43671992
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||| || ||||||||||||| ||||||| |
|
|
| T |
43671934 |
ggctaaaatatggtttttgtccctgtaaatatgcttcgttttggttttagttcctgtaa |
43671992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 311
Target Start/End: Original strand, 45442316 - 45442399
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaa |
311 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||| ||||| ||||| | | |||||||| || ||||||||||||||||||| |
|
|
| T |
45442316 |
ggctaaaatatggttttagtctctgcaaatatgtctcgttttgattttaattcgtgtaaaaaaaa----ttgtttttggtccctgcaa |
45442399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 234 - 279
Target Start/End: Complemental strand, 33576076 - 33576031
Alignment:
| Q |
234 |
tggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
33576076 |
tggttttagtccctgcaaatatgtctcattttggttttggtccctg |
33576031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #169
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 285
Target Start/End: Complemental strand, 45442696 - 45442635
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| ||| ||||||||||||||| || ||||| |
|
|
| T |
45442696 |
ggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccttgaaaaaa |
45442635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #170
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 224 - 284
Target Start/End: Original strand, 2481193 - 2481253
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
||||||||||||||||| || | |||||||||| ||| |||||||||||||||||| |||| |
|
|
| T |
2481193 |
ggctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtccctgcaaaa |
2481253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #171
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 227 - 318
Target Start/End: Complemental strand, 1696452 - 1696361
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||| |||| |||||| |||||||| ||| ||||||||| | || ||||||||| | | ||||||||||||| |||||||||||| |
|
|
| T |
1696452 |
taaaatatgattttcgtcccttcaaatatgtctcgttttggtttcaatctctgtaaaaaatatttgttgtttttggtccatgcaaaatattt |
1696361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #172
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 227 - 282
Target Start/End: Complemental strand, 13850881 - 13850826
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||| || ||||||||||||| || |||||||||||||| |||||| |
|
|
| T |
13850881 |
taaaatatggttttggttcctgcaaatatgcttcgttttggttttagtctctgtaa |
13850826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #173
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 4423968 - 4424010
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4423968 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
4424010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #174
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 4794203 - 4794245
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4794203 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
4794245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #175
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 292
Target Start/End: Complemental strand, 19604979 - 19604909
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaatt |
292 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||| ||||||| |||||| |||||| ||||||| |||||| |
|
|
| T |
19604979 |
tggctaaaatatgtttttggtccctgtaaatatggctcatttgggttttggtccctggtaaaaaaaaaatt |
19604909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #176
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 29182168 - 29182226
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||| |||| |||| |||||||||| ||||||||||||||||| |||||| |
|
|
| T |
29182168 |
ggctaaaatatgattttggtccttgcaaatatgtttcattttggttttagtctctgtaa |
29182226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #177
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 226 - 283
Target Start/End: Original strand, 25299747 - 25299804
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||| |||| |||||||||||||||| |
|
|
| T |
25299747 |
ctaaaatatgattttggtccctgcaaatatgactcgttttaattttagtccctgtaaa |
25299804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #178
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 224 - 310
Target Start/End: Complemental strand, 32691635 - 32691558
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgca |
310 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||| |||||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
32691635 |
ggctaaaacatggttttagtccctgcaaatatgtctc------gttttagtccttgtaaaaaaaaa---ttgtttttggtccctgca |
32691558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #179
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 224 - 281
Target Start/End: Complemental strand, 35155619 - 35155562
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta |
281 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| || ||||| |||||||||||||| |
|
|
| T |
35155619 |
ggctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtccctgta |
35155562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #180
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 282
Target Start/End: Complemental strand, 1295549 - 1295489
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
1295549 |
ttggttaaaatatggttttgattcctgcaaatatgtttcgttttggttttagtccctgtaa |
1295489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #181
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 224 - 300
Target Start/End: Complemental strand, 2412487 - 2412411
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgttttt |
300 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| | ||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
2412487 |
ggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctggtaaaaaaaaattttgttttt |
2412411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #182
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 227 - 275
Target Start/End: Complemental strand, 3832634 - 3832586
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
275 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
3832634 |
taaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
3832586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #183
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 26709696 - 26709782
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| ||| ||||||| |||||| |||||||| | || | | ||||||||||||||||| |
|
|
| T |
26709696 |
ggctaaaatatgattttagttcctgcaaatatgtctcgttttggtcttagtct-tgtaaaaaaataaatgt-tttttggtccctgcaaa |
26709782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #184
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 282
Target Start/End: Original strand, 38231429 - 38231489
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
38231429 |
ttggctaaaatatgattttgatccctgcaaatataccttgttttgattttagtccctgtaa |
38231489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #185
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 226 - 282
Target Start/End: Original strand, 44993806 - 44993861
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||| |||||| |||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
44993806 |
ctaaaatatggttgtagtcc-tgcaaatatgtctcgttttggttttactccctgtaa |
44993861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #186
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 250 - 285
Target Start/End: Original strand, 3172194 - 3172229
Alignment:
| Q |
250 |
aaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3172194 |
aaatatgcctcattttggttttagtccatgtaaaaa |
3172229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #187
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 224 - 271
Target Start/End: Complemental strand, 13215365 - 13215318
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggtttt |
271 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| ||| |||||||||| |
|
|
| T |
13215365 |
ggctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt |
13215318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #188
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 224 - 283
Target Start/End: Original strand, 13850522 - 13850581
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||| ||||| || ||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
13850522 |
ggctaaaatatagttttgatctctgcaaatatgtctcgatttggttttagtccctgtaaa |
13850581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #189
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 237 - 272
Target Start/End: Complemental strand, 16900135 - 16900100
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggtttta |
272 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16900135 |
ttttagtccctgcaaatatgcctcgttttggtttta |
16900100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #190
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 237 - 272
Target Start/End: Complemental strand, 16993526 - 16993491
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggtttta |
272 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16993526 |
ttttagtccctgcaaatatgcctcgttttggtttta |
16993491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #191
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 229 - 284
Target Start/End: Complemental strand, 26062572 - 26062517
Alignment:
| Q |
229 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
||||||| ||||||||||| ||||||| || |||||| |||||||||||| ||||| |
|
|
| T |
26062572 |
aaatatgtttttagtccctacaaatataccacatttttgttttagtccctctaaaa |
26062517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #192
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 229 - 284
Target Start/End: Complemental strand, 26068311 - 26068256
Alignment:
| Q |
229 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
||||||| ||||||||||| ||||||| || |||||| |||||||||||| ||||| |
|
|
| T |
26068311 |
aaatatgtttttagtccctacaaatataccacatttttgttttagtccctctaaaa |
26068256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #193
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 267 - 318
Target Start/End: Complemental strand, 29832110 - 29832060
Alignment:
| Q |
267 |
gttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
29832110 |
gttttagtccctgtaaaat-aaattgttgtttttggtccctgcaaaatattt |
29832060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #194
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 146399 - 146441
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
146399 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
146441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #195
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 2481266 - 2481308
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
2481266 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
2481308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #196
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 271
Target Start/End: Original strand, 3832344 - 3832378
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggtttt |
271 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
3832344 |
ttttagtccctgcaaatatgtctcattttggtttt |
3832378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #197
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 4042817 - 4042775
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
4042817 |
ttttggtccctacaaatatgcctcattttggttttggtccctg |
4042775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #198
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 5334967 - 5334925
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
5334967 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
5334925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #199
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 10671703 - 10671745
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
10671703 |
ttttggtccctgcaaatatgcttcattttggttttggtccctg |
10671745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #200
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 15842534 - 15842576
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
15842534 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
15842576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #201
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 16673484 - 16673526
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
16673484 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
16673526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #202
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 271
Target Start/End: Original strand, 18113162 - 18113196
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggtttt |
271 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
18113162 |
ttttggtccctgcaaatatgcctcattttggtttt |
18113196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #203
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 20131390 - 20131432
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
20131390 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
20131432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #204
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 23732256 - 23732214
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
23732256 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
23732214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #205
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 24358872 - 24358830
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
24358872 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
24358830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #206
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 25705376 - 25705334
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
25705376 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
25705334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #207
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 29859560 - 29859602
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
29859560 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
29859602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #208
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 30215495 - 30215537
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
30215495 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
30215537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #209
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 271
Target Start/End: Original strand, 34317871 - 34317905
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggtttt |
271 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
34317871 |
ttttggtccctgcaaatatgcctcattttggtttt |
34317905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #210
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 37911047 - 37911005
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
37911047 |
ttttggtccatgcaaatatgcctcattttggttttggtccctg |
37911005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #211
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 40125039 - 40125081
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
40125039 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
40125081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #212
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 242 - 312
Target Start/End: Complemental strand, 41594318 - 41594248
Alignment:
| Q |
242 |
gtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| | ||||| |||| ||||||||||| |
|
|
| T |
41594318 |
gtccctgcaaatatctgacattttggttttagtccctgtaaaaatatttttttggttttagtccctgcaaa |
41594248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #213
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 285
Target Start/End: Complemental strand, 2395526 - 2395481
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2395526 |
tagtccctgcaaatatctgacattttggttttagtccctgtaaaaa |
2395481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #214
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 285
Target Start/End: Original strand, 18369027 - 18369072
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
18369027 |
tagtccctgcaaatatctgacattttggttttagtccctgtaaaaa |
18369072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #215
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 285
Target Start/End: Complemental strand, 19204962 - 19204917
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||| |||||| | |||||||||||||||||| |||||||| |
|
|
| T |
19204962 |
tagtccctgtaaatatccgtcattttggttttagtccttgtaaaaa |
19204917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #216
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 223 - 255
Target Start/End: Original strand, 2411261 - 2411293
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatat |
255 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
2411261 |
tggctaaaatatgcttttagtccctgcaaatat |
2411293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #217
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 272
Target Start/End: Original strand, 13802486 - 13802534
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
272 |
Q |
| |
|
|||||||||||||||||||| | || |||||| |||| ||||||||||| |
|
|
| T |
13802486 |
ggctaaaatatggttttagttcttgtaaatattcctcgttttggtttta |
13802534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #218
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 312
Target Start/End: Original strand, 14379147 - 14379199
Alignment:
| Q |
260 |
cattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||| |||| ||||||||||| |
|
|
| T |
14379147 |
cattttggttttagtccctgtaaaaatatttttttggttttagtccctgcaaa |
14379199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #219
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 226 - 274
Target Start/End: Complemental strand, 25300038 - 25299991
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
274 |
Q |
| |
|
||||||||||||||| ||||||||||||||| || ||||||||||||| |
|
|
| T |
25300038 |
ctaaaatatggttttggtccctgcaaatatgtttc-ttttggttttagt |
25299991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #220
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 312
Target Start/End: Complemental strand, 28921562 - 28921490
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||| | ||||| |||| ||||||||||| |
|
|
| T |
28921562 |
tagtccctgcaaatatatgacattttggttttaatccctgtaaaaatatttttttggttttagtccctgcaaa |
28921490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #221
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 252
Target Start/End: Complemental strand, 29311628 - 29311600
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaa |
252 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29311628 |
ggctaaaatatggttttagtccctgcaaa |
29311600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #222
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 312
Target Start/End: Complemental strand, 29683543 - 29683471
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||| | ||||| |||| ||||||||||| |
|
|
| T |
29683543 |
tagtccctgcaaatatctgacattttgattttagtccctgtaaaaatatttttttggttttagtccctgcaaa |
29683471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #223
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 284
Target Start/End: Original strand, 30432610 - 30432654
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30432610 |
tagtccctgcaaatatctgacattttggttttagtccctgtaaaa |
30432654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #224
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 312
Target Start/End: Complemental strand, 30432944 - 30432892
Alignment:
| Q |
260 |
cattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||| |||| ||||||||||| |
|
|
| T |
30432944 |
cattttggttttagtccctgtaaaaatatttttttggttttagtccctgcaaa |
30432892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #225
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 243 - 279
Target Start/End: Original strand, 41451916 - 41451952
Alignment:
| Q |
243 |
tccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
41451916 |
tccctgcaaatatgtctcattttggttttggtccctg |
41451952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #226
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 252
Target Start/End: Complemental strand, 42358871 - 42358843
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaa |
252 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42358871 |
ggctaaaatatggttttagtccctgcaaa |
42358843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 87; Significance: 1e-41; HSPs: 211)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 27341591 - 27341497
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27341591 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttatttttggtccctgcaaaatattt |
27341497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 224 - 315
Target Start/End: Original strand, 7272420 - 7272511
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaata |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7272420 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgtaaaaagaaaattttgtttttggtccctgctaaata |
7272511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 43477163 - 43477253
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
43477163 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaat |
43477253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 225 - 312
Target Start/End: Complemental strand, 6146948 - 6146861
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6146948 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaaaataaaaattttgtttttggtccctgcaaa |
6146861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 10337119 - 10337213
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
10337119 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
10337213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 16644044 - 16643954
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
16644044 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctggtaaaacaaaattttgtttttggtccctgcaaaat |
16643954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 224 - 317
Target Start/End: Original strand, 11976373 - 11976465
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatatt |
317 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
11976373 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaa-aaattgttgtttttggtccctgcaaaatatt |
11976465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 222 - 318
Target Start/End: Complemental strand, 7272753 - 7272657
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| | || ||||||||||||||||||||||| |||| |
|
|
| T |
7272753 |
ttggctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctgtaaacaaaattttttgtttttggtccctgcaaaaaattt |
7272657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 10776501 - 10776409
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |||| |||||||| ||||||||||||| |
|
|
| T |
10776501 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaaaaattgttttttgtccctgcaaaat |
10776409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 223 - 314
Target Start/End: Complemental strand, 16789370 - 16789281
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| ||||||||||||||| ||||||| |
|
|
| T |
16789370 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaa--aaaaatttgtttttggtcccagcaaaat |
16789281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 25131449 - 25131358
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |||||| ||||| |||||||||||||||||||||| |
|
|
| T |
25131449 |
ttggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctctaaaaa-aaaatattgtttttggtccctgcaaaat |
25131358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 1408353 - 1408265
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |||| |||||||||||||||||||||| |
|
|
| T |
1408353 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctataaaaaaaaaa--ttgtttttggtccctgcaaaat |
1408265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 32418318 - 32418406
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |||| |||||||||||||||||||||| |
|
|
| T |
32418318 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
32418406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 1525809 - 1525899
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
1525809 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtctctggcaaaaaaaaaatttgtttttggtccctgcaaaat |
1525899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 6469280 - 6469374
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||| ||||||||||||| |||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
6469280 |
ggctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
6469374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 7420590 - 7420496
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||| |||||||||||||||||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
7420590 |
ggctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattt |
7420496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 8298975 - 8298881
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
8298975 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattt |
8298881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 14495069 - 14495158
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
14495069 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaa-aaaaaattgtttttggtccctgcaaaat |
14495158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 29158354 - 29158444
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| ||| |||||||||| |||||||||||| |
|
|
| T |
29158354 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaataaaatttgtttttgatccctgcaaaat |
29158444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 33636322 - 33636412
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||| | |||| |||||||||||||||||||||||||||| |
|
|
| T |
33636322 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccccggtaaaaaaaaattttgtttttggtccctgcaaaat |
33636412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 40066822 - 40066733
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
40066822 |
ttggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtccctgtaaa---aaaaatttgtttttggtccctgcaaaat |
40066733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 222 - 314
Target Start/End: Original strand, 40844154 - 40844243
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
40844154 |
ttggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
40844243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 223 - 314
Target Start/End: Original strand, 4375691 - 4375779
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
4375691 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
4375779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 10540782 - 10540686
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaa--ttttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| || |||||||||||||||||||||||| |||| | |||||||||||||||||||||||||| |
|
|
| T |
10540782 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaaaaattgttgtttttggtccctgcaaaatattt |
10540686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 225 - 318
Target Start/End: Complemental strand, 24090487 - 24090394
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||||||| ||||||||| ||| | ||||||||||||||| |||||||||| |
|
|
| T |
24090487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtctctgtaaaaaaaaattgttgtttttggtccctacaaaatattt |
24090394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 29488110 - 29488024
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
29488110 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaaaaaaaaaa--ttgtttttggtccctgcaaa |
29488024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 14239080 - 14238993
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
14239080 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtgaaaa-aaaaaattgtttttggtccctgcaaa |
14238993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 24815068 - 24814980
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| | ||||||||||||| |||||||||||||||||||||||||||| ||| | |||||||||||||||||||| |
|
|
| T |
24815068 |
ggctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtccctgtaaaaaaaaattattgtttttggtccctgcaaa |
24814980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 34963300 - 34963388
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| ||| | |||||||||||||||||||| |
|
|
| T |
34963300 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaa |
34963388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 42133156 - 42133064
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| || | |||||||||||||||||||||| |
|
|
| T |
42133156 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaat |
42133064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 223 - 314
Target Start/End: Original strand, 1162908 - 1162999
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||| |||||||||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
1162908 |
tggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaat |
1162999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 3511906 - 3512000
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||||||||| |
|
|
| T |
3511906 |
ggctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattt |
3512000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 4710220 - 4710126
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| | | |||||||||||||||||||||||||| |
|
|
| T |
4710220 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattt |
4710126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 225 - 314
Target Start/End: Original strand, 6146517 - 6146604
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||| |||||||| |||| |||||||||||||||||||||| |
|
|
| T |
6146517 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
6146604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 10872915 - 10873009
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| || | |||||||| ||||||||||||||||| |
|
|
| T |
10872915 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgtaaaaataatttgttgtttttagtccctgcaaaatattt |
10873009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 16643661 - 16643750
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
16643661 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggtaaaa-aaaaatttgtttttggtccctgcaaaat |
16643750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 20984510 - 20984416
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| ||| |||||||||||||||||||||||| ||| | |||||||||||||| ||||||||||| |
|
|
| T |
20984510 |
ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatattt |
20984416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 28323849 - 28323942
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| || ||||||||||||||||| |||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
28323849 |
ggctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtccctttaaaaa-aaattgttgtttttggtccctgcaaaatattt |
28323942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 222 - 312
Target Start/End: Complemental strand, 35097694 - 35097604
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
35097694 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
35097604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 37536086 - 37536180
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| | | |||||||||||||||||||||||||| |
|
|
| T |
37536086 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaatattttgttgtttttggtccctgcaaaatattt |
37536180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 38930664 - 38930574
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||||| |||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
38930664 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttaatccctggtaaaaaaaaaatttgtttttggtccctgcaaaat |
38930574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 223 - 312
Target Start/End: Original strand, 8298586 - 8298675
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| || | |||||||||||||||||||| |
|
|
| T |
8298586 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
8298675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 22650464 - 22650556
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaa--aattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||||||| || ||| |||||||||||||||||||||| |
|
|
| T |
22650464 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaaataatattgtttttggtccctgcaaaat |
22650556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 7326086 - 7326174
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||| |||||||||||||||||| ||||| ||| | |||||||||||||||||||| |
|
|
| T |
7326086 |
ggctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaa |
7326174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 226 - 318
Target Start/End: Original strand, 13779151 - 13779243
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||| ||||||||||| |||||||||||| ||||| |||||||||||| ||||||||||||| |
|
|
| T |
13779151 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttattccctgtaaaaaaaaaatgttgtttttggtctctgcaaaatattt |
13779243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 20984146 - 20984234
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| || | |||||||||||||||||||| |
|
|
| T |
20984146 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
20984234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 33526412 - 33526325
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |||| |||| ||||||||||||||||||||| |
|
|
| T |
33526412 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtgaaaaaaaaa---tgtttttggtccctgcaaaat |
33526325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 35345617 - 35345530
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||| ||| ||||||||||||||| |||||| |
|
|
| T |
35345617 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttaatccctgtaaaaa-aaacttttgtttttggtccttgcaaa |
35345530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 227 - 314
Target Start/End: Original strand, 1685117 - 1685204
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| || |||| |||| ||||||||||||| ||||||||| |
|
|
| T |
1685117 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttggtaaaaaaaaaatttgtttttggtcactgcaaaat |
1685204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 225 - 314
Target Start/End: Original strand, 4016906 - 4016992
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |||||| ||||| |||| ||||||||||||||||||||| |
|
|
| T |
4016906 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgcaaaaaaaaaa---tgtttttggtccctgcaaaat |
4016992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 22917564 - 22917655
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||| ||| ||||||||||| |||||| |
|
|
| T |
22917564 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaaattgattttggtccctacaaaat |
22917655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 222 - 312
Target Start/End: Complemental strand, 2728599 - 2728509
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| | | |||||||||||||||||||| |
|
|
| T |
2728599 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
2728509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 8094479 - 8094569
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||| |||||||||||||||||| |||| |||| || |||||||||||||||||||| |
|
|
| T |
8094479 |
ggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaattcgtttttggtccctgcaaaat |
8094569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 8094841 - 8094751
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||||| | |||| |||| |||||||||||| |||||||||| |
|
|
| T |
8094841 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccccggtaaaaaaaaaatttgtttttggttcctgcaaaat |
8094751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 13155251 - 13155157
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||| ||||||||||| |||||||||||| ||| | ||||||||| |||||||||||||||| |
|
|
| T |
13155251 |
ggctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatccctgtaaaaaaaaattattgtttttgatccctgcaaaatattt |
13155157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 28346394 - 28346488
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| | |||||||||||||||||||||||||| |
|
|
| T |
28346394 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaaatattt |
28346488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 222 - 312
Target Start/End: Complemental strand, 37536421 - 37536331
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| || |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
37536421 |
ttggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
37536331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 223 - 312
Target Start/End: Complemental strand, 4621355 - 4621266
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||| |||||||||||||||||||||||| || | ||||||||||| |||||||| |
|
|
| T |
4621355 |
tggctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaataatttgttgtttttggttcctgcaaa |
4621266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 25131111 - 25131197
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||| ||||||||| ||||| ||| |||||||||||||||| |
|
|
| T |
25131111 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaaaa--aaaatattgattttggtccctgcaaa |
25131197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 29992300 - 29992211
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||| ||||| |||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
29992300 |
ggctcaaatatggttttgttccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaaattgttgtttttggtccctgcaaa |
29992211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 223 - 312
Target Start/End: Original strand, 35346628 - 35346717
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
35346628 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
35346717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 3512266 - 3512178
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
3512266 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
3512178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 9496723 - 9496635
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| || |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
9496723 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
9496635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 11019857 - 11019769
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| | | |||||||||||||||||||| |
|
|
| T |
11019857 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
11019769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 28346758 - 28346670
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| | | |||||||||||||||||||| |
|
|
| T |
28346758 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaatattttgttgtttttggtccctgcaaa |
28346670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 32726271 - 32726183
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| | | |||||||||||||||||||| |
|
|
| T |
32726271 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
32726183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 21125719 - 21125807
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||||||||||| |||||||| ||| |||| |||||||||||||||| ||||| |
|
|
| T |
21125719 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgtataaaaaaaa--ttgtttttggtccctgtaaaat |
21125807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 35143844 - 35143756
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| ||| || ||||||||||| |||||||||||||||||| ||||| |||| |||||||||||||||||||||| |
|
|
| T |
35143844 |
ggctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtccctgaaaaaaaaaaa--ttgtttttggtccctgcaaaat |
35143756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 5357423 - 5357517
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| ||||||||||||||||| |||||| | | ||||||||||| |||||||||||||| |
|
|
| T |
5357423 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctataaaaaaattttgttgtttttggttcctgcaaaatattt |
5357517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 14238751 - 14238839
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |||| |||| ||||||||||| |||||||||| |
|
|
| T |
14238751 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtgaaaa-aaaaaattgtttttggt-cctgcaaaat |
14238839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 14489075 - 14488986
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| ||| ||||||||||||| | |||||| |
|
|
| T |
14489075 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccgtacaaaat |
14488986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 222 - 312
Target Start/End: Original strand, 15719654 - 15719743
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||| ||||||| |||| ||||||||||||| |||||| |
|
|
| T |
15719654 |
ttggctaaaatatggttttagtccctgcaaatatatctcgttttggttttagtcccggtaaaaa-aaaaaattgtttttggtccttgcaaa |
15719743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 226 - 314
Target Start/End: Complemental strand, 18549571 - 18549486
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| |||| |||||||||||| |||||||| |
|
|
| T |
18549571 |
ctaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaaa---tgtttttggtccttgcaaaat |
18549486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 19494119 - 19494208
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||| |||| ||| ||||||||||||||||||||||| |
|
|
| T |
19494119 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctggtaaaa-aaatatttgtttttggtccctgcaaaat |
19494208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 25702512 - 25702606
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||| |||| ||||||||||||||| || ||| | ||||||||||||| |||||||||||| |
|
|
| T |
25702512 |
ggctaaaatatggttttggtccctgtaaatatgcctcgttttaattttagtccctgtaagaaaaaattgttgtttttggtccatgcaaaatattt |
25702606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 27117753 - 27117846
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| ||||| |||||||||||||||||| ||| | ||||||||||||||||||||| |||| |
|
|
| T |
27117753 |
ggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgtaaaaa-aaattgttgtttttggtccctgcaaaagattt |
27117846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 38930302 - 38930391
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||| ||||||||||||| |||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
38930302 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcctggtaaaa-aaaaatttgtttttggtccctgcaaaat |
38930391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 14488716 - 14488802
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||| |||||||||||||| |||||||| |||| |||||||||||||| |||||| |
|
|
| T |
14488716 |
ggctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagtctctgtaaaa--aaaaatttgtttttggtccttgcaaa |
14488802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 224 - 313
Target Start/End: Original strand, 19962995 - 19963084
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||| ||| |||| |||||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
19962995 |
ggctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtccctgtaaaataaaatttttgtttttgatccctgcaaaa |
19963084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 25600230 - 25600319
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||| |||||||||| | | || |||||||||||||||||||| |
|
|
| T |
25600230 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgtaaaaaaatatttgttgtttttggtccctgcaaa |
25600319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 223 - 314
Target Start/End: Original strand, 1408004 - 1408093
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||| |||| ||||||| |||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
1408004 |
tggctaaaatatggttttagtccatgcaaatatgtctcgttttagttttagctcctgtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
1408093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 223 - 283
Target Start/End: Complemental strand, 7326422 - 7326362
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7326422 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
7326362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 7420230 - 7420318
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| ||||| | | | |||||||| ||||||||||| |
|
|
| T |
7420230 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaagattgttgtttttagtccctgcaaa |
7420318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 221 - 312
Target Start/End: Complemental strand, 29158672 - 29158583
Alignment:
| Q |
221 |
gttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||| ||||||||||||||| |||||||| |||| ||||||||||||| |||||| |
|
|
| T |
29158672 |
gttggctaaaatatggttttaatccctgcaaatatatctcgttttggttttagtccttgtaaaaaaaaaa--ttgtttttggtccttgcaaa |
29158583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 222 - 318
Target Start/End: Complemental strand, 34963666 - 34963570
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |||| | |||||||||||||||||||||||||| |
|
|
| T |
34963666 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttattgtttttggtccctgcaaaatattt |
34963570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 40066497 - 40066583
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||||||| |||||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
40066497 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcctgtaaaaaaaaa---ttgtttttggt-cctgcaaaat |
40066583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 4017300 - 4017213
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||||||| |||| |||| ||||||||| || |||||||||| |
|
|
| T |
4017300 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgcaaaa--aaaaatttgttttttgt-cctgcaaaat |
4017213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 224 - 279
Target Start/End: Complemental strand, 19494413 - 19494358
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19494413 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19494358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 227 - 318
Target Start/End: Complemental strand, 28497616 - 28497525
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||| ||||||||| |
|
|
| T |
28497616 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaatttttatgttgtttttggtccctgaaaaatattt |
28497525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 226 - 312
Target Start/End: Original strand, 43727097 - 43727184
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt-aaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||| ||||||| ||||| ||||| |||| ||||||||||||||||||||| |
|
|
| T |
43727097 |
ctaaaatatggttttagtccctgcaaatatgcattgttttgattttagttcctgtaaaaaaaaaaaatttgtttttggtccctgcaaa |
43727184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 308
Target Start/End: Complemental strand, 1526172 - 1526089
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctg |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||| | || |||||||||||||||| |
|
|
| T |
1526172 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctggtaaaaaaataa--ttgtttttggtccctg |
1526089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 17073807 - 17073865
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17073807 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
17073865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 17574463 - 17574405
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17574463 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
17574405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 290
Target Start/End: Original strand, 18549201 - 18549267
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaa |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| ||||||||| |||| |
|
|
| T |
18549201 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtctctgtaaaaaaaaaa |
18549267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 24187569 - 24187654
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || |||||||||||||||||||||||| ||| |||||||||| || |||||| |
|
|
| T |
24187569 |
ggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggcccgtgcaaa |
24187654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 28399035 - 28398950
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || |||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
28399035 |
ggctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtccctgtaaaaaaa-----ttgtttttggtccctgcaaaat |
28398950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 227 - 317
Target Start/End: Original strand, 29991918 - 29992008
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatatt |
317 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||| |||| ||||||||| ||||||||| ||| | ||||||||||||| | ||||||||| |
|
|
| T |
29991918 |
taaaatatggttttggtctctgcaaatatgcctcgttttagttttagtctctgtaaaaaaaaattattgtttttggtccttacaaaatatt |
29992008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 224 - 285
Target Start/End: Complemental strand, 4474044 - 4473983
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4474044 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgtaaaaa |
4473983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 227 - 312
Target Start/End: Original strand, 13232201 - 13232286
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| | | |||||||| ||||||||||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaatattttgttgtttttagtccctgcaaa |
13232286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 14496816 - 14496902
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| || ||||||||||||||||| |||||| || ||||||||||||| |||||||| |
|
|
| T |
14496816 |
ggctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagtccctataaaaaaaa----ttgtttttggtccttgcaaaat |
14496902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 224 - 285
Target Start/End: Original strand, 16789075 - 16789136
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||||||| |
|
|
| T |
16789075 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaaaaa |
16789136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 222 - 314
Target Start/End: Original strand, 29487748 - 29487838
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| || ||||||||||||||| ||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
29487748 |
ttggctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagtccatgtgaaaaaaaaa--ttgtttttggtccctgcaaaat |
29487838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 1163276 - 1163185
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| | |||| ||||||||| ||| |||| |||| |||||||||||||||| |||||| |
|
|
| T |
1163276 |
ttggctaaaatatggttttagtccatgcaaatatgccccgttttagttttagtcgctggtaaaa-aaaaatttgtttttggtccctacaaaat |
1163185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 4473704 - 4473792
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||| | ||| |||||||||||||||||| ||||| || | |||||||| ||||||||||| |
|
|
| T |
4473704 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttagtccctgcaaa |
4473792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 222 - 282
Target Start/End: Complemental strand, 7186006 - 7185946
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
7186006 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
7185946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 224 - 313
Target Start/End: Complemental strand, 24955010 - 24954923
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||| ||| || |||||||||| ||||||| |
|
|
| T |
24955010 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctagtaaaaaaaaa---ttatttttggtccttgcaaaa |
24954923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 224 - 310
Target Start/End: Original strand, 26530668 - 26530751
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgca |
310 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||| |||||||| |||||||||| ||| ||||||||||||| |||| |
|
|
| T |
26530668 |
ggcttaaatatggttttagtccatgcaaatatgcctcattttagttttagttcctgtaaaaaaaaa---ttgtttttggtccttgca |
26530751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 225 - 314
Target Start/End: Complemental strand, 7578527 - 7578442
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||| ||||||| | |||||||||||| ||||||||||||||||| |||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
7578527 |
gctaaaatacggttttaattcctgcaaatatgactcattttggttttagt-cctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
7578442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 13232563 - 13232512
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
274 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
13232563 |
tggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
13232512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 25600597 - 25600502
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttg-tttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| || |||||||||||||||||||||||| ||| | ||| ||||| |||| |||||||||||| |
|
|
| T |
25600597 |
ggctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgtaaaaaaaaattgttgtttttttgtccttgcaaaatattt |
25600502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 227 - 305
Target Start/End: Complemental strand, 40844532 - 40844456
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtcc |
305 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| || | |||||||||||||| |
|
|
| T |
40844532 |
taaaatatggttttagtccctgcaaatatatctcgttttggttttagtccctgtaaaa--aataatttgtttttggtcc |
40844456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 9496341 - 9496435
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||| |||| |||| | |||||||||||||||||||||||||| |
|
|
| T |
9496341 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaaatttttttgttgtttttggtccctgcaaaatattt |
9496435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 222 - 284
Target Start/End: Complemental strand, 10873282 - 10873220
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
10873282 |
ttggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgcaaaa |
10873220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 157 - 223
Target Start/End: Complemental strand, 19946414 - 19946348
Alignment:
| Q |
157 |
tcatgaagttgtgtattttgaaaaggacgatcaactttcaacctaagtaacaacgaagttttatgtt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |||||| |||| || ||||| |
|
|
| T |
19946414 |
tcatgaagttgtgtattttgaaaaggacaatcaactttcaacctaactaacaatgaagcttcatgtt |
19946348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 20277692 - 20277750
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
20277692 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgtaa |
20277750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 21064319 - 21064377
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
21064319 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgtaa |
21064377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 21126021 - 21125932
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||| |||||||||| || ||||||| ||| |||||||||||||||||||||||| |||| ||||||||| | |||||||||| |
|
|
| T |
21126021 |
ggctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtccctgtaaaaa-aaaaaattgtttttgattcctgcaaaat |
21125932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 278
Target Start/End: Complemental strand, 27117976 - 27117922
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct |
278 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27117976 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttggtccct |
27117922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 32725907 - 32726001
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
32725907 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattt |
32726001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 35097328 - 35097422
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
35097328 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattt |
35097422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 35346998 - 35346904
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
35346998 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattt |
35346904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 40492960 - 40493018
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
40492960 |
ggctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctgtaa |
40493018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 222 - 312
Target Start/End: Original strand, 42132862 - 42132952
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||| |||||| ||||| || | || ||||||||| ||||||| |
|
|
| T |
42132862 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctgcaaaaaaaatttgttatttttggtctctgcaaa |
42132952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 42430120 - 42430062
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
42430120 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccttgtaa |
42430062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 222 - 312
Target Start/End: Complemental strand, 44998265 - 44998176
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||| || || |||||||| ||| ||||||||||||| |||||||||| ||| | |||||||||||||||||||| |
|
|
| T |
44998265 |
ttggctaaaatatggttttgatctctacaaatatgtctcgttttggttttagt-cctgtaaaaaaaaattgttgtttttggtccctgcaaa |
44998176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 1778562 - 1778619
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
1778562 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1778619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 224 - 285
Target Start/End: Complemental strand, 10755528 - 10755467
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||| |||||| |
|
|
| T |
10755528 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccctctaaaaa |
10755467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 227 - 312
Target Start/End: Complemental strand, 11976733 - 11976648
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| |||||||||||||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
11976733 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaa |
11976648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 224 - 284
Target Start/End: Complemental strand, 10337449 - 10337389
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||| |||| |
|
|
| T |
10337449 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgcaaaa |
10337389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 224 - 284
Target Start/End: Original strand, 11019520 - 11019580
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |||| |
|
|
| T |
11019520 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaa |
11019580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 224 - 292
Target Start/End: Complemental strand, 24187897 - 24187829
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt |
292 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||||||| || || |||||| |
|
|
| T |
24187897 |
ggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccctgcaagaaaaaaatt |
24187829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 28324181 - 28324094
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| || |||||||||||||||||||||||| ||| | || |||||||||||| |||| |
|
|
| T |
28324181 |
ggctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtccctgtaaaaa-aaattgttatttttggtccctacaaa |
28324094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 227 - 318
Target Start/End: Complemental strand, 13796593 - 13796502
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
13796593 |
taaaatatggtttggatccctgcaaatatgtctcattttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaaatattt |
13796502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 229 - 276
Target Start/End: Original strand, 24814710 - 24814757
Alignment:
| Q |
229 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtcc |
276 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24814710 |
aaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
24814757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 2728232 - 2728326
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
2728232 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattt |
2728326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 20278057 - 20277999
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||| ||||||||||||||| ||||| |
|
|
| T |
20278057 |
ggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtccttgtaa |
20277999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 21064684 - 21064626
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||| ||||||||||||||| ||||| |
|
|
| T |
21064684 |
ggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtccttgtaa |
21064626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 290
Target Start/End: Original strand, 32040075 - 32040141
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaa |
290 |
Q |
| |
|
|||||||||||| | |||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
32040075 |
ggctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaaa |
32040141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 42429758 - 42429815
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
42429758 |
ggctaaaatatggttttggtccctacaaatatgcctca-tttggttttagtccctgtaa |
42429815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 225 - 282
Target Start/End: Complemental strand, 13779531 - 13779474
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
13779531 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagcccctgtaa |
13779474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 225 - 277
Target Start/End: Complemental strand, 14495389 - 14495337
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccc |
277 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
14495389 |
gctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagtccc |
14495337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 223 - 276
Target Start/End: Original strand, 33526051 - 33526104
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtcc |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
33526051 |
tggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtcc |
33526104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 227 - 283
Target Start/End: Complemental strand, 9175368 - 9175312
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| |||||||||||||| ||||||| |
|
|
| T |
9175368 |
taaaatatggttttggtccctgtaaatatgcctcgttttggttttagtctctgtaaa |
9175312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 226 - 282
Target Start/End: Original strand, 10776150 - 10776206
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||| ||| ||||| |
|
|
| T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccttgtaa |
10776206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 224 - 291
Target Start/End: Complemental strand, 4376010 - 4375944
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaat |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||| ||||| |
|
|
| T |
4376010 |
ggctaaaatatggttttagtccctgcaaatatgcttc-gtttggttttagtcaatgtaaaaaaaaaat |
4375944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 224 - 283
Target Start/End: Original strand, 9175012 - 9175071
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||||||| |||| |||| |||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
9175012 |
ggctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctgtaaa |
9175071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 227 - 278
Target Start/End: Original strand, 14847828 - 14847879
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct |
278 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14847828 |
taaaatatgattttgatccctgcaaatatgcctcattttggttttagtccct |
14847879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 227 - 318
Target Start/End: Original strand, 33652193 - 33652284
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||| |||||||| ||||||| | |||||||||||||||||||||||||| |
|
|
| T |
33652193 |
taaaatatgattttagtccctgcaaatatgcctcgttttagttttagtttctgtaaattttttttgttgtttttggtccctgcaaaatattt |
33652284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 224 - 279
Target Start/End: Complemental strand, 35115639 - 35115584
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||| |||||||||| ||||||| |
|
|
| T |
35115639 |
ggctaaaatatggttttagtccctacaaatatacctcgttttggttttggtccctg |
35115584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 226 - 285
Target Start/End: Complemental strand, 43727431 - 43727373
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||| ||||||||||||||| |||||||| |
|
|
| T |
43727431 |
ctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtccttgtaaaaa |
43727373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 7420303 - 7420345
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7420303 |
ttttagtccctgcaaatatgcctcattttggttttggtccctg |
7420345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 9832215 - 9832308
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||| ||||||||| |||| |||||||||| | ||||||||||| |||||||||||| || | ||||||||||||||| |||||||||| |
|
|
| T |
9832215 |
ggctaaattatggttttggtccttgcaaatatgttttgttttggttttaatccctgtaaaaa-aagttgttgtttttggtcccttcaaaatattt |
9832308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 10540449 - 10540503
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct |
278 |
Q |
| |
|
||||||||||| ||||| ||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
10540449 |
ggctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagtccct |
10540503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 13154886 - 13154944
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||| ||||| ||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13154886 |
ggctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagtccctgtaa |
13154944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 13232271 - 13232313
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13232271 |
ttttagtccctgcaaatatgcctcattttggttttggtccctg |
13232313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 222 - 260
Target Start/End: Original strand, 28398754 - 28398792
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctc |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28398754 |
ttggctaaaatatggttttagtccctgcaaatatgcctc |
28398792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 28497255 - 28497313
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |||| |||||||||| ||||| |
|
|
| T |
28497255 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagtccatgtaa |
28497313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 269
Target Start/End: Complemental strand, 40493158 - 40493112
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggtt |
269 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40493158 |
tggctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt |
40493112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 229 - 282
Target Start/End: Original strand, 3680532 - 3680585
Alignment:
| Q |
229 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
3680532 |
aaatatggttttgctccctgcaaatatgactcgttttggttttagtccctgtaa |
3680585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 311
Target Start/End: Original strand, 27341258 - 27341342
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaa |
311 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||| ||||||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
27341258 |
ggctaaaatatggttttaactcctgcaaatatgccttgttttgattttagtccttgtaaaaaagaa---ttgtttttggtccctgcaa |
27341342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 236 - 316
Target Start/End: Complemental strand, 1778917 - 1778837
Alignment:
| Q |
236 |
gttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatat |
316 |
Q |
| |
|
||||| ||||||||||||||| ||| ||||||||||| |||||||||||| | | ||||||||| |||||| ||||||| |
|
|
| T |
1778917 |
gttttggtccctgcaaatatgtctcgttttggttttaatccctgtaaaaaaattttgttgtttttgttccctgtaaaatat |
1778837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 222 - 292
Target Start/End: Complemental strand, 3031604 - 3031533
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaatt |
292 |
Q |
| |
|
|||||||||||||| |||| ||||||| ||||||| ||||||| |||||| |||||| ||||||| |||||| |
|
|
| T |
3031604 |
ttggctaaaatatgtttttggtccctgtaaatatggctcatttaggttttggtccctggtaaaaaaaaaatt |
3031533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 224 - 279
Target Start/End: Complemental strand, 3680801 - 3680746
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
3680801 |
ggctaaaatatgattttgatccctgcaaatatgcctcgttttggttttggtccctg |
3680746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 227 - 318
Target Start/End: Complemental strand, 14848186 - 14848096
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||| ||||| ||| |||||||||| ||| |||||||||||||||| |||||| | |||||||||||||||||||||||||| |
|
|
| T |
14848186 |
taaaatatgattttaatcc-tgcaaatatgtctcgttttggttttagtccccgtaaaatttttgtgttgtttttggtccctgcaaaatattt |
14848096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 224 - 275
Target Start/End: Complemental strand, 31445463 - 31445412
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
275 |
Q |
| |
|
||||||||||| ||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
31445463 |
ggctaaaatatagttttgatccctacaaatatgcctcattttggttttagtc |
31445412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 224 - 283
Target Start/End: Original strand, 44997931 - 44997990
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| ||||| ||||| | |||||||| |
|
|
| T |
44997931 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttaattcctgtaaa |
44997990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 4473777 - 4473819
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
4473777 |
ttttagtccctgcaaatatgccttattttggttttggtccctg |
4473819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 225 - 275
Target Start/End: Complemental strand, 5357762 - 5357712
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
275 |
Q |
| |
|
||||||||||| |||| |||||||||||||||| || |||||||||||||| |
|
|
| T |
5357762 |
gctaaaatatgattttggtccctgcaaatatgcttcgttttggttttagtc |
5357712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 8298660 - 8298702
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8298660 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
8298702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 10540522 - 10540564
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10540522 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
10540564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 225 - 283
Target Start/End: Original strand, 15930933 - 15930991
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||| |||| || ||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
15930933 |
gctaaaatatgattttggttcctacaaatatgtctcgttttggttttagtccctgtaaa |
15930991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 290
Target Start/End: Complemental strand, 28258241 - 28258176
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaa |
290 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| ||| ||||||||||||| |||||||||| |||| |
|
|
| T |
28258241 |
ggctaaaatatggttttaacctctgcaaatatgtctcgttttggttttagt-cctgtaaaaaaaaaa |
28258176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 270
Target Start/End: Complemental strand, 30337217 - 30337171
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttt |
270 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
30337217 |
ggctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
30337171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 225 - 283
Target Start/End: Original strand, 30969399 - 30969457
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||||||||||| |||| | |||||||| || |||||||||||||||||||||| |
|
|
| T |
30969399 |
gctaaaatatggttttggtccttacaaatatgtttcgttttggttttagtccctgtaaa |
30969457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 265 - 314
Target Start/End: Complemental strand, 33636646 - 33636596
Alignment:
| Q |
265 |
tggttttagtccctg-taaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
33636646 |
tggttttagtccctggtaaaaaaaaaaatttgtttttggtccctgcaaaat |
33636596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 44998191 - 44998149
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44998191 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
44998149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #177
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 224 - 265
Target Start/End: Complemental strand, 25702809 - 25702768
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcatttt |
265 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
25702809 |
ggctaaaatatggttttggtccctgcaaatatgtctcatttt |
25702768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #178
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 223 - 260
Target Start/End: Complemental strand, 30969718 - 30969681
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctc |
260 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30969718 |
tggctaaaatatggttttggtccctgcaaatatgcctc |
30969681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #179
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 222 - 275
Target Start/End: Original strand, 32195278 - 32195331
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
275 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||| |||||||| |||||||| |
|
|
| T |
32195278 |
ttggctaaaatatggttttggtccctacaaatatgtctcattttaattttagtc |
32195331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #180
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 225 - 282
Target Start/End: Complemental strand, 36044791 - 36044734
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||||| |||||||||||| || ||| ||||||||||| || |||||| |
|
|
| T |
36044791 |
gctaaaatatggttttggtccctgcaaatgtgtctcgttttggttttaatctctgtaa |
36044734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #181
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 227 - 275
Target Start/End: Complemental strand, 2811778 - 2811730
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
275 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||| |||||||||||||| |
|
|
| T |
2811778 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
2811730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #182
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 23939545 - 23939597
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
274 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| ||| |||| |||||||| |
|
|
| T |
23939545 |
ttggctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagt |
23939597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #183
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 250 - 301
Target Start/End: Original strand, 24954697 - 24954749
Alignment:
| Q |
250 |
aaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttg |
301 |
Q |
| |
|
||||||||||| ||||||||||||| ||| ||||||| ||||||||||||||| |
|
|
| T |
24954697 |
aaatatgcctcgttttggttttagttcctggtaaaaaaaaaattttgtttttg |
24954749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #184
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 224 - 259
Target Start/End: Complemental strand, 21509918 - 21509883
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcct |
259 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21509918 |
ggctaaaatatgattttagtccctgcaaatatgcct |
21509883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #185
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 237 - 280
Target Start/End: Original strand, 25600304 - 25600347
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctgt |
280 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
25600304 |
ttttggtccctgcaaatatgccttattttggttttggtccctgt |
25600347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #186
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 240 - 299
Target Start/End: Original strand, 26479340 - 26479399
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttt |
299 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |||| || ||||| |
|
|
| T |
26479340 |
tagtccctgcaaatatttgacattttggttttagtccctgtaaaaaaaaaaattggtttt |
26479399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #187
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 265 - 314
Target Start/End: Complemental strand, 32040330 - 32040284
Alignment:
| Q |
265 |
tggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
32040330 |
tggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
32040284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #188
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 1778637 - 1778679
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
1778637 |
ttttggtccttgcaaatatgcctcattttggttttggtccctg |
1778679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #189
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 2728524 - 2728482
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
2728524 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
2728482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #190
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 3512193 - 3512151
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
3512193 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
3512151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #191
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 4709979 - 4710021
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
4709979 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
4710021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #192
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 6469667 - 6469609
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||| | ||||||||||||||||||||| |
|
|
| T |
6469667 |
ggctaaaatatgattttggtcactgcaaatatgttacgttttggttttagtccctgtaa |
6469609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #193
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 7326159 - 7326201
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
7326159 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
7326201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #194
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 9496650 - 9496608
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
9496650 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
9496608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #195
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 245 - 279
Target Start/End: Complemental strand, 10873200 - 10873166
Alignment:
| Q |
245 |
cctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10873200 |
cctgcaaatatgcctcattttggttttggtccctg |
10873166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #196
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 11019593 - 11019635
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
11019593 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
11019635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #197
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 11976663 - 11976621
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
11976663 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
11976621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #198
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 20277765 - 20277807
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| ||||||| |
|
|
| T |
20277765 |
ttttagtccctgcaaatatgcttcgttttggttttggtccctg |
20277807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #199
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 20984219 - 20984261
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
20984219 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
20984261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #200
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 21064392 - 21064434
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| ||||||| |
|
|
| T |
21064392 |
ttttagtccctgcaaatatgcttcgttttggttttggtccctg |
21064434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #201
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 262 - 312
Target Start/End: Complemental strand, 26479641 - 26479591
Alignment:
| Q |
262 |
ttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| |||||| |||| |||| |||| ||||||||||| |
|
|
| T |
26479641 |
ttttggttttagtccctataaaaaaaaaaatttggttttagtccctgcaaa |
26479591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #202
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 28346685 - 28346643
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
28346685 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
28346643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #203
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 34963373 - 34963415
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
34963373 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
34963415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #204
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 35097619 - 35097577
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
35097619 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
35097577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #205
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 37536346 - 37536304
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
37536346 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
37536304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #206
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 42132937 - 42132979
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
42132937 |
ttttggtctctgcaaatatgcctcattttggttttggtccctg |
42132979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #207
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 42430047 - 42430005
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
42430047 |
tttttgtccctgcaaatatgcctcgttttggttttggtccctg |
42430005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #208
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 222 - 255
Target Start/End: Complemental strand, 4184040 - 4184007
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatat |
255 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
4184040 |
ttggctaaaatatgcttttagtccctgcaaatat |
4184007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #209
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 312
Target Start/End: Complemental strand, 3273089 - 3273017
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||| | ||||| |||| ||||||||||| |
|
|
| T |
3273089 |
tagtccctgcaaatatctgacattttggttttagtccctataaaaatatttttttgattttagtccctgcaaa |
3273017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #210
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 312
Target Start/End: Complemental strand, 6944026 - 6943954
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||| | ||||| |||| ||||||||||| |
|
|
| T |
6944026 |
tagtccctgcaaatatctgacattttggttttagttcctgtaaaaatatttttttggttttagtccctgcaaa |
6943954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #211
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 292
Target Start/End: Complemental strand, 15719979 - 15719911
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt |
292 |
Q |
| |
|
||||||||||| ||||||| ||||||||||| || ||||||||||| ||| |||||||| |||||| |
|
|
| T |
15719979 |
ggctaaaatataattttagtttctgcaaatatgtcttgttttggttttaatccttgtaaaaaaaaaatt |
15719911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 85; Significance: 2e-40; HSPs: 247)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 35308113 - 35308021
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35308113 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttgtttttggtcccttcaaaat |
35308021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 224 - 310
Target Start/End: Complemental strand, 26442899 - 26442813
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgca |
310 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26442899 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgca |
26442813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 48956068 - 48955976
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
48956068 |
ttggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaaaataaaaattttgtttttggtccctgcaaaat |
48955976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 222 - 317
Target Start/End: Complemental strand, 38151214 - 38151119
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatatt |
317 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
38151214 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt |
38151119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 26442563 - 26442653
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26442563 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccatgtaaaaaggaaattttgtttttggtccctgcaaaat |
26442653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 29072497 - 29072587
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
29072497 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaat |
29072587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 35307715 - 35307805
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
35307715 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaagaaaattttgtttttggtccttgtaaaat |
35307805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 42482979 - 42483074
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||| ||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
42482979 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtctctgtaaaaaaaaaattgttgtttttggtccctgcaaaatattt |
42483074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 3247198 - 3247292
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
3247198 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
3247292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 8140434 - 8140528
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
8140434 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
8140528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 13770489 - 13770578
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |||||||||||||| |||||||| |
|
|
| T |
13770489 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaa-aaaaatttgtttttggtccttgcaaaat |
13770578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 19720712 - 19720806
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
19720712 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
19720806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 7001899 - 7001807
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| || | ||||||||||||||||||||||| |
|
|
| T |
7001899 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaataatttgtttttggtccctgcaaaat |
7001807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 222 - 318
Target Start/End: Original strand, 10631162 - 10631258
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| ||| | |||||||||||||| ||||||||||| |
|
|
| T |
10631162 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatattt |
10631258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 222 - 318
Target Start/End: Original strand, 24653800 - 24653896
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||||||||| |
|
|
| T |
24653800 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattt |
24653896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 227 - 314
Target Start/End: Complemental strand, 15335292 - 15335205
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaataaaaattttgtttttggtccctgcaaaat |
15335205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 990379 - 990290
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
990379 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaa-aaaaatttgtttttggtccctgcaaaat |
990290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 12361011 - 12361100
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||| |||| ||||||||| ||||||||||||| |
|
|
| T |
12361011 |
ggctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctgtaaaaa-aaaagtttgtttttcgtccctgcaaaat |
12361100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 24507843 - 24507749
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
24507843 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaattttgttgtttttggtccctgcaaaatattt |
24507749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 45368490 - 45368579
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| ||||||||||| |||||||||| |
|
|
| T |
45368490 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaa-aaaaaattgtttttggttcctgcaaaat |
45368579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 220 - 318
Target Start/End: Complemental strand, 45380640 - 45380542
Alignment:
| Q |
220 |
tgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||||||||| |
|
|
| T |
45380640 |
tgttggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattt |
45380542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 47819596 - 47819502
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||||||||| |
|
|
| T |
47819596 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattt |
47819502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 50429209 - 50429120
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |||| |||||||||||| |||||||||| |
|
|
| T |
50429209 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaa-aaaaatttgtttttggttcctgcaaaat |
50429120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 313
Target Start/End: Original strand, 50799130 - 50799217
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| ||| ||||||| |
|
|
| T |
50799130 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaaa--ttgtttttgatccttgcaaaa |
50799217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 225 - 314
Target Start/End: Original strand, 4323829 - 4323918
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |||||||| |||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtctctgtaaaataaaaattttgtttttagtccctgcaaaat |
4323918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 29072864 - 29072771
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta-aaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
29072864 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctgtaaaaaaaaaaaaattgtttttggtccctgcaaaat |
29072771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 224 - 317
Target Start/End: Original strand, 33000305 - 33000398
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatatt |
317 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||||||||| || | ||||||||||||||||||||||||| |
|
|
| T |
33000305 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatatt |
33000398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 225 - 314
Target Start/End: Original strand, 3753214 - 3753299
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
3753214 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaa----ttgtttttggtccctgcaaaat |
3753299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 14007489 - 14007576
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
14007489 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
14007576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 16060887 - 16060795
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || | ||||||||||||| || ||||| |
|
|
| T |
16060887 |
ttggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgtaaaat |
16060795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 18473272 - 18473361
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
18473272 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
18473361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 22919684 - 22919771
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| ||||||||||||| |||||||| |
|
|
| T |
22919684 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccttgcaaaat |
22919771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 222 - 314
Target Start/End: Original strand, 24649348 - 24649439
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| ||||| |||| ||||||||||| ||||||||||| |
|
|
| T |
24649348 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagcccctg-aaaaaaaaaaatttgtttttggcccctgcaaaat |
24649439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 32729049 - 32728960
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
32729049 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
32728960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 223 - 314
Target Start/End: Original strand, 37545627 - 37545716
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| ||||| |||| |||||||||||||||||||||| |
|
|
| T |
37545627 |
tggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaaa--ttgtttttggtccctgcaaaat |
37545716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 224 - 311
Target Start/End: Original strand, 1810927 - 1811014
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaa |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |||| |||||||||||||| ||||| |
|
|
| T |
1810927 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtgcaaaaaaaaatttgtttttggtccttgcaa |
1811014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 227 - 318
Target Start/End: Original strand, 7350426 - 7350516
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| | |||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
7350426 |
taaaatatggttttagtccctgcaaatatgtctcattttggttttagtccttataaaaa-aaattgttgtttttggtccctgcaaaatattt |
7350516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 11822004 - 11822092
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |||| ||||||||||||| |||||||| |
|
|
| T |
11822004 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaa--ttgtttttggtccttgcaaaat |
11822092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 18473595 - 18473505
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||| || |||||||||||||||||||| |
|
|
| T |
18473595 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctagtaaaaaaaaaaatt-gtttttggtccctgcaaaat |
18473505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 19622655 - 19622745
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccc-tgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
19622655 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcccttgtaaaaa-aaaaatttgtttttggtccctgcaaaat |
19622745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 19623017 - 19622925
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |||| |||| |||||||||||||||||||||||||| |
|
|
| T |
19623017 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaa--ttgtttttggtccctgcaaaatattt |
19622925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 33379888 - 33379976
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |||| |||| |||||||||||||||||||||| |
|
|
| T |
33379888 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctatgaaaaaaaaa--ttgtttttggtccctgcaaaat |
33379976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 48609236 - 48609324
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||| |||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
48609236 |
ggctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccctgtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
48609324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 222 - 311
Target Start/End: Complemental strand, 52254481 - 52254395
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaa |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
52254481 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaaa---tgtttttggtccctgcaa |
52254395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 7819103 - 7819013
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||| |||||||||||||| ||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
7819103 |
ggctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagtctctgtaaaaaaaaaaaattgtttttggtccctgcaaaat |
7819013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 10887598 - 10887504
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||| |||||| || | |||||||||||||||||||||||||| |
|
|
| T |
10887598 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctctaaaaaaaatttgttgtttttggtccctgcaaaatattt |
10887504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 26061956 - 26062046
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||| || ||||||||||||||||||| |
|
|
| T |
26061956 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattatttttggtccctgcaaaat |
26062046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 26324585 - 26324679
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |||||||||||||||||||||||| ||| | ||||||||| ||| |||||||||||| |
|
|
| T |
26324585 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttgatccttgcaaaatattt |
26324679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 31258339 - 31258429
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |||| || | ||||||||||||||||||||||| |
|
|
| T |
31258339 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggtaaaaaaataatttgtttttggtccctgcaaaat |
31258429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 38164295 - 38164201
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| | | |||||||||||||||||||||||||| |
|
|
| T |
38164295 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattt |
38164201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 222 - 304
Target Start/End: Original strand, 41738794 - 41738876
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtc |
304 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| ||| | |||||||||||| |
|
|
| T |
41738794 |
ttggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagtccctgtaaaaaaaaattgttgtttttggtc |
41738876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 225 - 314
Target Start/End: Original strand, 44641079 - 44641166
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |||| ||||||||||||| |||||||| |
|
|
| T |
44641079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctataaaaaaaaaa--ttgtttttggtccttgcaaaat |
44641166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 224 - 313
Target Start/End: Original strand, 21391096 - 21391184
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |||| |||| ||||||||||||||||||||| |
|
|
| T |
21391096 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtgaaaa-aaaaaattgtttttggtccctgcaaaa |
21391184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 222 - 314
Target Start/End: Original strand, 26191357 - 26191447
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||||||||||| |||||||| |||| ||||||||||||| |||||||| |
|
|
| T |
26191357 |
ttggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttgtaaaaaaaaaa--ttgtttttggtccttgcaaaat |
26191447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 224 - 313
Target Start/End: Original strand, 41881093 - 41881182
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||| |||||||||||||||||| |||| |||||||| |||||||||||||||||| |
|
|
| T |
41881093 |
ggctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctggtaaaaaaaaattttatttttggtccctgcaaaa |
41881182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 223 - 314
Target Start/End: Complemental strand, 44641433 - 44641345
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||||| ||||| |
|
|
| T |
44641433 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgtaaaat |
44641345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 215 - 312
Target Start/End: Original strand, 46183675 - 46183772
Alignment:
| Q |
215 |
ttttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||| |||| ||||||||||||||| |||||||||||||||| || |||||||||||||||| ||||||| ||| | |||||||||||||||||||| |
|
|
| T |
46183675 |
ttttaagttgactaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccccgtaaaaaaaaattgttgtttttggtccctgcaaa |
46183772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 224 - 305
Target Start/End: Complemental strand, 48609594 - 48609513
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtcc |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||||||| |||| |||||||||||||| |
|
|
| T |
48609594 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcactgtaaaaataaaaatttgtttttggtcc |
48609513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 990088 - 990176
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
990088 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaa |
990176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 316
Target Start/End: Complemental strand, 8140799 - 8140707
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatat |
316 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||||||| |
|
|
| T |
8140799 |
ggctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatat |
8140707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 227 - 314
Target Start/End: Complemental strand, 18900130 - 18900045
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| || |||| |||||||||||||||||||||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgtaataaaaaaa--ttgtttttggtccctgcaaaat |
18900045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 220 - 312
Target Start/End: Complemental strand, 38136985 - 38136893
Alignment:
| Q |
220 |
tgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
38136985 |
tgttggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
38136893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 45290820 - 45290731
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
45290820 |
ggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
45290731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 3753572 - 3753484
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |||| |||| ||||||||||||| |||||||| |
|
|
| T |
3753572 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgtgaaaaaaaaa--ttgtttttggtccgtgcaaaat |
3753484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 222 - 312
Target Start/End: Original strand, 24977776 - 24977867
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| ||||| ||| || |||||||||||||||||||| |
|
|
| T |
24977776 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaaatttgttgtttttggtccctgcaaa |
24977867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 32454294 - 32454201
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt---ttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
32454294 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctgtaaaaaaaaaaaaaaattgtttttggtccctgcaaaat |
32454201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 6567496 - 6567411
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| ||| ||||||||||| |||||||| |
|
|
| T |
6567496 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggttcctgcaaa |
6567411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 225 - 314
Target Start/End: Original strand, 7818783 - 7818870
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||||||| ||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
7818783 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtttctgtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
7818870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 317
Target Start/End: Original strand, 16026573 - 16026667
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctgcaaaatatt |
317 |
Q |
| |
|
||||||||||| |||| |||||||||||||| |||| ||||||||||||||||| |||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
16026573 |
ggctaaaatataattttggtccctgcaaatatccctcgttttggttttagtccctttaaaaaaaaaattgttgtttttggtccctgcaaaatatt |
16026667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 290
Target Start/End: Complemental strand, 18302387 - 18302321
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaa |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
18302387 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaa |
18302321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 222 - 317
Target Start/End: Original strand, 20948753 - 20948850
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt--aaaaagaaaattttgtttttggtccctgcaaaatatt |
317 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||| ||| ||| ||||||||||||||| ||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
20948753 |
ttggctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtccctgtagaaaaacaaatttttgtttttggtccctgcaaaatatt |
20948850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 22919977 - 22919888
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||| |||||||||| |||||||| ||||| ||||||||||||| |||||||| |
|
|
| T |
22919977 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagtccttgtaaaaa-aaaatgttgtttttggtccgtgcaaaat |
22919888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 222 - 312
Target Start/End: Original strand, 24507477 - 24507567
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
24507477 |
ttggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
24507567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 225 - 314
Target Start/End: Original strand, 27521577 - 27521664
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||||||| |||| ||||||||||| |||||||||| |
|
|
| T |
27521577 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaaaa--ttgtttttggttcctgcaaaat |
27521664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 32626529 - 32626619
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||||||| |||| |||||||||||| |||||||| |
|
|
| T |
32626529 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaaaaaaaaaaaaatgtttttggtccttgcaaaat |
32626619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 39747835 - 39747741
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| || | ||||||||| ||| |||||||||||| |
|
|
| T |
39747835 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttgatccttgcaaaatattt |
39747741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 222 - 312
Target Start/End: Original strand, 45638578 - 45638668
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| || |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
45638578 |
ttggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
45638668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 45638894 - 45638800
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||| | ||| |||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
45638894 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaattcctataaaaaaaaattgttgtttttggtccctgcaaaatattt |
45638800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 213 - 314
Target Start/End: Original strand, 48955703 - 48955802
Alignment:
| Q |
213 |
agttttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||| || |||||||||||| |||||||||||||||||||||||| |||||||||||||| ||| |||| |||| |||||||||||||||||||| |
|
|
| T |
48955703 |
agttttaggtaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtctttgttaaaaaaaaa--ttgtttttggtccctgcaaa |
48955800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 52254183 - 52254268
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
52254183 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaa---ttgtttttggtccctgcaaa |
52254268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 229 - 314
Target Start/End: Complemental strand, 16083394 - 16083310
Alignment:
| Q |
229 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||| |||||||| ||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
16083394 |
aaatatggttttagtccctgcaaatatacctcgttttgattttagtctctgtaaaaa-aaaaatttgtttttggtccctgcaaaat |
16083310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 227 - 314
Target Start/End: Original strand, 18899842 - 18899926
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||| |||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
18899842 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
18899926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 228 - 308
Target Start/End: Complemental strand, 24649656 - 24649575
Alignment:
| Q |
228 |
aaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa-gaaaattttgtttttggtccctg |
308 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
24649656 |
aaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaataaaaaatttgtttttggtccctg |
24649575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 215 - 312
Target Start/End: Complemental strand, 30323302 - 30323205
Alignment:
| Q |
215 |
ttttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||| | |||||||||||| |||| ||||||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
30323302 |
ttttatttaggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
30323205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 227 - 312
Target Start/End: Original strand, 38163934 - 38164019
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
38163934 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
38164019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 21383104 - 21383191
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||| ||| |||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
21383104 |
ggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgtaaaaataaaa---tgtttttggtccctgcaaaat |
21383191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 226 - 318
Target Start/End: Original strand, 29579322 - 29579414
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| |||||||||||||||||| || | ||||||||| |||||||||||||||| |
|
|
| T |
29579322 |
ctaaaatatggtttttgtccttgcaaatatgcctcattttaattttagtccctgtaaaaaaaatttgttgtttttgatccctgcaaaatattt |
29579414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 222 - 318
Target Start/End: Original strand, 31060785 - 31060881
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || |||||||||||||||||| ||||| | | |||||||||||||||||||||||||| |
|
|
| T |
31060785 |
ttggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattt |
31060881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 35056894 - 35056806
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
35056894 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
35056806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 44158042 - 44157954
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |||||| || | |||||||||||||||||||| |
|
|
| T |
44158042 |
ggctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagtccctataaaaaaaatttgttgtttttggtccctgcaaa |
44157954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 45290457 - 45290546
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||| |||| |||||||||||||| ||||||| |
|
|
| T |
45290457 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtcccagcaaaat |
45290546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 46868226 - 46868314
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||| ||||||||||||||||| ||||||||| |||| |||||||||||||| ||||| |
|
|
| T |
46868226 |
ggctaaattatgattttagtccctgcaaatatgcttcattttggttttagtctctgtaaaaaaaaaaaattgtttttggtcccagcaaa |
46868314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 224 - 313
Target Start/End: Original strand, 3679626 - 3679712
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| ||| |||||| |||||| ||||||| |
|
|
| T |
3679626 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaaaaaaaaa---ttgtttctggtccttgcaaaa |
3679712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 17984333 - 17984426
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt---aaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||||||||| |||| ||||| |||| |||||||||||||||||||||| |
|
|
| T |
17984333 |
ggctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagtctctgttaaaaaaaaaaaaaattgtttttggtccctgcaaaat |
17984426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 223 - 318
Target Start/End: Complemental strand, 39025382 - 39025289
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||| ||||||||||||||||| |||||| ||| | ||||||||||||||||||| |||||| |
|
|
| T |
39025382 |
tggctaaaatatggttttggtccctgcaaa-atgcctcgttttggttttagtccctataaaaa-aaattgttgtttttggtccctgcaagatattt |
39025289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 229 - 312
Target Start/End: Original strand, 2939934 - 2940013
Alignment:
| Q |
229 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaa----ttgtttttggtccctgcaaa |
2940013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 223 - 312
Target Start/End: Complemental strand, 3679987 - 3679900
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||| ||||||||||||| |||| |||| |||||||||||||| ||||| |
|
|
| T |
3679987 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctgttaaaaaaaaa--ttgtttttggtcccggcaaa |
3679900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 223 - 293
Target Start/End: Complemental strand, 26191735 - 26191665
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattt |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |||||||| ||||||| |
|
|
| T |
26191735 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaaaaaaaaaattt |
26191665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 33234546 - 33234604
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33234546 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
33234604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 41358663 - 41358574
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||| |||| ||| ||||||||||||||||||||||| |
|
|
| T |
41358663 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctggtaaaa-aaatatttgtttttggtccctgcaaaat |
41358574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 50428873 - 50428963
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||| ||||| ||||| |||||||||||| | | ||||||||||||||||||||||| |
|
|
| T |
50428873 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttgcttttaatccctgtaaaaaaatatatttgtttttggtccctgcaaaat |
50428963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 29688428 - 29688343
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |||||| || |||||||||||||||||||||| |
|
|
| T |
29688428 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccct-taaaaaaaa----ttgtttttggtccctgcaaaat |
29688343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 227 - 314
Target Start/End: Complemental strand, 31258699 - 31258613
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |||||||||||| ||||||| |||| |||||||||||||||| ||||| |
|
|
| T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgtaaaat |
31258613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 226 - 313
Target Start/End: Complemental strand, 45368847 - 45368763
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||| |||||||||||||||||||||||| ||| || |||||||||||||||||| |
|
|
| T |
45368847 |
ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa---ttatttttggtccctgcaaaa |
45368763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 227 - 316
Target Start/End: Complemental strand, 46184051 - 46183962
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatat |
316 |
Q |
| |
|
|||||||| ||||| ||||||| ||||||| |||||||||||||| ||||||||||||| ||| | |||||||||||||||| ||||||| |
|
|
| T |
46184051 |
taaaatatagttttggtccctgtaaatatgtctcattttggttttcgtccctgtaaaaaaaaattgttgtttttggtccctgaaaaatat |
46183962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 10631528 - 10631440
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| ||||| || | |||||||||||| ||||||| |
|
|
| T |
10631528 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtctctgcaaa |
10631440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 10887233 - 10887321
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
10887233 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
10887321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 13259988 - 13260075
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||| |||||||||||||||||||||||| ||| ||||||||| |||||| ||||| |
|
|
| T |
13259988 |
ggctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttgttccctgtaaaat |
13260075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 24654167 - 24654079
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||| ||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
24654167 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
24654079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 222 - 314
Target Start/End: Original strand, 25658012 - 25658103
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||| ||| ||||||||||| |||||||||||| || | |||||||||||||||||||||| |
|
|
| T |
25658012 |
ttggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttaatccctgtaaaaa-aatttgttgtttttggtccctgcaaaat |
25658103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 227 - 312
Target Start/End: Original strand, 34808200 - 34808281
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||| |||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
34808200 |
taaaatatggttttagtcccttcaaatatgtctcgttttggttttagtccctgtaaaaaaaaa----tgtttttggtccctgcaaa |
34808281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 222 - 313
Target Start/End: Complemental strand, 46868579 - 46868490
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||| |||||||||||||||||| ||||| |||| ||||||||| ||| ||||||| |
|
|
| T |
46868579 |
ttggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctggaaaaaaaaaa--ttgtttttgctccttgcaaaa |
46868490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 224 - 279
Target Start/End: Complemental strand, 16026938 - 16026883
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16026938 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16026883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 227 - 310
Target Start/End: Complemental strand, 26062255 - 26062172
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgca |
310 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||||||||| |||| |||| |||| ||||||||||| ||||||| |
|
|
| T |
26062255 |
taaaatatggttttagtccctgtaaatatgtctcattttggttttagttcctggtaaaaaaaaaatttgtttttggcccctgca |
26062172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 224 - 283
Target Start/End: Complemental strand, 33045690 - 33045631
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33045690 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
33045631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 224 - 279
Target Start/End: Original strand, 41358369 - 41358424
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41358369 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41358424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 233 - 314
Target Start/End: Original strand, 292868 - 292947
Alignment:
| Q |
233 |
atggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||| |||||| |||| |||||||||||| ||||||||| |
|
|
| T |
292868 |
atggttttagtccctgcaaatatgcctcgttttgcttttagtccctataaaaaaaaaa--ttgtttttggtctctgcaaaat |
292947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 12360968 - 12360874
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
12360968 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaattttttttgttgtttttggtccctgcaaaatattt |
12360874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 15526362 - 15526268
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |||| | |||||||||||||||||||||||||| |
|
|
| T |
15526362 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattt |
15526268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 215 - 305
Target Start/End: Complemental strand, 22953565 - 22953476
Alignment:
| Q |
215 |
ttttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtcc |
305 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||| |||||||||||| ||||| |||| |||| ||||||||||||| |
|
|
| T |
22953565 |
ttttctgttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagatcctgtgaaaa-aaaaaattgtttttggtcc |
22953476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 26142420 - 26142509
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||| |||||| || | ||||||||||||| |||||||||||||| ||||||||| |||| ||||||||| ||||||||||||| |
|
|
| T |
26142420 |
ggctaaaatatagttttactctccgcaaatatgcctcgttttggttttagtcactgtaaaaa-aaaaatttgttttttgtccctgcaaaat |
26142509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 30322929 - 30323023
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |||| | |||||||||||||||||||||||||| |
|
|
| T |
30322929 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattt |
30323023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 215 - 312
Target Start/End: Original strand, 33045346 - 33045444
Alignment:
| Q |
215 |
ttttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||| | ||||||||| ||||||| |||||||||||||||||| |||||||||||||||||||||||| | || |||||||||||||||||||| |
|
|
| T |
33045346 |
ttttatttaggctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtccctgtaaaaaaatttttgttgtttttggtccctgcaaa |
33045444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 225 - 291
Target Start/End: Original strand, 39303675 - 39303741
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaat |
291 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||| |||||||||||||||||||||||| ||||| |
|
|
| T |
39303675 |
gctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccctgtaaaaaaaaaat |
39303741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 220 - 318
Target Start/End: Original strand, 40718106 - 40718204
Alignment:
| Q |
220 |
tgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
40718106 |
tgttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattt |
40718204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 222 - 312
Target Start/End: Complemental strand, 40718476 - 40718386
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| | ||||| |||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
40718476 |
ttggctaaaatatggttttggtccctgcaaatatgcatagttttgattttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
40718386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 225 - 283
Target Start/End: Original strand, 44157696 - 44157754
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
44157754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 49073691 - 49073785
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||| ||||||||||| ||||| ||||| ||| | |||||||||||||||||| ||||||| |
|
|
| T |
49073691 |
ggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttaatccctacaaaaaaaaattgttgtttttggtccctgcagaatattt |
49073785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 227 - 312
Target Start/End: Complemental strand, 3247559 - 3247474
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
3247559 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaattttttgttgtttttggtccctgcaaa |
3247474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 224 - 285
Target Start/End: Complemental strand, 13260321 - 13260260
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| ||||| |
|
|
| T |
13260321 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgcaaaaa |
13260260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 226 - 318
Target Start/End: Original strand, 17129691 - 17129781
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||| | |||||||||||||||| ||||||||||||||||||||||| ||||||| | |||||||| |||||||||||| |
|
|
| T |
17129691 |
ctaaaatatggttttgattcctgcaaatatgcctcgttttggttttagtccctgtaaaa--aaaatttgttgtttggtccttgcaaaatattt |
17129781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 224 - 276
Target Start/End: Complemental strand, 35005744 - 35005692
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtcc |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35005744 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
35005692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 41739120 - 41739029
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41739120 |
ggctaaaatatggttttagtccctgcaaatat---tcgttttggttttagtccctgtaaatttttgtttttgtttttggtccctgcaaaatattt |
41739029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 224 - 284
Target Start/End: Original strand, 47819232 - 47819292
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
47819232 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaa |
47819292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 229 - 304
Target Start/End: Complemental strand, 4789639 - 4789564
Alignment:
| Q |
229 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtc |
304 |
Q |
| |
|
|||| ||||||| |||||||||||||||| ||||||||||||| ||||||||||||| ||| | |||||||||||| |
|
|
| T |
4789639 |
aaatttggttttggtccctgcaaatatgcatcattttggttttggtccctgtaaaaaaaaattgttgtttttggtc |
4789564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 224 - 283
Target Start/End: Complemental strand, 11822365 - 11822306
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
11822365 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctgtaaa |
11822306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 318
Target Start/End: Complemental strand, 33234913 - 33234818
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| ||||| ||||||||||||||||| | ||||||||| |||||||||||||||| |
|
|
| T |
33234913 |
tggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttagtccctgtaaaatttttgtgttgtttttgatccctgcaaaatattt |
33234818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 224 - 283
Target Start/End: Complemental strand, 34002940 - 34002881
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
34002940 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctgtaaa |
34002881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 224 - 279
Target Start/End: Original strand, 35005444 - 35005499
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
35005444 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35005499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 318
Target Start/End: Original strand, 35056529 - 35056624
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
35056529 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattt |
35056624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 7867357 - 7867299
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
7867357 |
ggctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctgtaa |
7867299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 12360603 - 12360661
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
12360603 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagcccctgtaa |
12360661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 15058766 - 15058673
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||| ||||| |||||||||||||| ||| ||||||||||||| | |||||||| ||| | |||||||||||||| ||||||||||| |
|
|
| T |
15058766 |
ggctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagttcatgtaaaaa-aaattgttgtttttggtcccggcaaaatattt |
15058673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 306
Target Start/End: Original strand, 15516582 - 15516664
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccc |
306 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||| || | ||||||||| |||| |
|
|
| T |
15516582 |
ggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccctgcaaaaaaaatttgttgtttttgatccc |
15516664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 18079398 - 18079456
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||| |||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
18079398 |
ggctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtccctgtaa |
18079456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 290
Target Start/End: Complemental strand, 21383428 - 21383362
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaa |
290 |
Q |
| |
|
||||||||||| |||||| ||| |||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
21383428 |
ggctaaaatatagttttaatccttgcaaatatgcctcattttgattttagtccctgtaaaaaaaaaa |
21383362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 28507458 - 28507364
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| |||||||| |||||||||||||||| | ||||||||||||||||||||||| |||| |
|
|
| T |
28507458 |
ggctaaaatattgttttggtccctgcaaatatgtctcattttagttttagtccctgtaattttttatttttgtttttggtccctgcaaaacattt |
28507364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 222 - 283
Target Start/End: Complemental strand, 12322972 - 12322911
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
12322972 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctgtaaa |
12322911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 222 - 275
Target Start/End: Complemental strand, 17984703 - 17984650
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
275 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17984703 |
ttggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
17984650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 227 - 312
Target Start/End: Original strand, 38150851 - 38150936
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| |||||||||||||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
38150851 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaa |
38150936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 226 - 282
Target Start/End: Original strand, 4789310 - 4789366
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
4789310 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
4789366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 241 - 308
Target Start/End: Original strand, 18302070 - 18302135
Alignment:
| Q |
241 |
agtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctg |
308 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
18302070 |
agtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaaa--ttgtttttggtccctg |
18302135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 224 - 284
Target Start/End: Complemental strand, 33000669 - 33000609
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |||| |
|
|
| T |
33000669 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaa |
33000609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 39747474 - 39747561
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| |||| |||||||| | ||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
39747474 |
ggctaaaatatggttttggtcc-tgcaaatacgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
39747561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 223 - 313
Target Start/End: Complemental strand, 1159840 - 1159752
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
||||||||||||| ||||||| | ||||||| ||||| ||||||||||||||||||||||| |||| || ||||||| ||||||||||| |
|
|
| T |
1159840 |
tggctaaaatatgattttagttcttgcaaatgtgccttgttttggttttagtccctgtaaaa--aaaaattagtttttgatccctgcaaaa |
1159752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 224 - 283
Target Start/End: Original strand, 7867129 - 7867188
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||| |||| ||||||||||||||||| |
|
|
| T |
7867129 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgtaaa |
7867188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 224 - 279
Target Start/End: Original strand, 12158690 - 12158745
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| || |||||||||||||||||| |
|
|
| T |
12158690 |
ggctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtccctg |
12158745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 227 - 314
Target Start/End: Original strand, 20756022 - 20756108
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||| ||||| ||| || ||||||| ||| ||||||||||||||| |||||||| |||| |||||||||||||| |||||||| |
|
|
| T |
20756022 |
taaaatatgattttaatccttgtaaatatgtctcgttttggttttagtccttgtaaaaa-aaaaatttgtttttggtccttgcaaaat |
20756108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 226 - 285
Target Start/End: Original strand, 26207280 - 26207339
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||||| |||| |||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
26207280 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgtaaaaa |
26207339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 224 - 279
Target Start/End: Original strand, 45380272 - 45380327
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
45380272 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
45380327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 15211511 - 15211605
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| ||| |||||||||||||| ||||||| | |||||||||||||||||||||||||| |
|
|
| T |
15211511 |
ggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtctctgtaaatttttgttgttgtttttggtccctgcaaaatattt |
15211605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 26324947 - 26324889
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||| |||||||||||||| |||||| |
|
|
| T |
26324947 |
ggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagtctctgtaa |
26324889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 242 - 318
Target Start/End: Original strand, 37646760 - 37646833
Alignment:
| Q |
242 |
gtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||| || ||||| |||||||||||||||||| |||| ||||||| ||||||||||||||||| |
|
|
| T |
37646760 |
gtccctgcaaatatgcttcgttttgattttagtccctgtaaaaaaaaaa---tgttttttgtccctgcaaaatattt |
37646833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 224 - 285
Target Start/End: Complemental strand, 4360626 - 4360565
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| || |||||||| ||||||||||| |
|
|
| T |
4360626 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttggggttttagcccctgtaaaaa |
4360565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 225 - 282
Target Start/End: Original strand, 15058419 - 15058476
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
15058419 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccttgtaa |
15058476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 225 - 318
Target Start/End: Complemental strand, 18928141 - 18928048
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| |||||||| ||||||||||| |||| | | |||||||||||||||||||||||||| |
|
|
| T |
18928141 |
gctaaaatatggttttggtcgctgcaaatatgtctcattttagttttagtcccggtaacatttttttattgtttttggtccctgcaaaatattt |
18928048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 225 - 282
Target Start/End: Complemental strand, 19198948 - 19198891
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19198948 |
gctaaaatatggttttgatctctgcaaatatgcctcattttgcttttagtccctgtaa |
19198891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 227 - 284
Target Start/End: Complemental strand, 19721071 - 19721014
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaa |
19721014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 227 - 313
Target Start/End: Complemental strand, 21391371 - 21391289
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||| ||||||||| |||| |||| || |||||||||||| |||||||| |
|
|
| T |
21391371 |
taaaatatggttttagtccctgtaaatatgcctcgttttagttttagtctctgtgaaaaaaa----ttgtttttggtctctgcaaaa |
21391289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 225 - 290
Target Start/End: Original strand, 34382948 - 34383012
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaa |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||| |||| |
|
|
| T |
34382948 |
gctaaaatatggttttagtccctgcaaatatacctc-gtttggttttagtctctgtaaaaaaaaaa |
34383012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 227 - 283
Target Start/End: Complemental strand, 5058989 - 5058933
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| ||||| |||||||||||||||| |
|
|
| T |
5058989 |
taaaatatggttttggtccctggaaatatgcctcgttttgattttagtccctgtaaa |
5058933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 222 - 282
Target Start/End: Original strand, 15466130 - 15466190
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||||| |||| | | ||||||||||||||||||||||||||||||| |
|
|
| T |
15466130 |
ttggctaaaatatggttttggtccttacggatatgcctcattttggttttagtccctgtaa |
15466190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 16083047 - 16083141
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaa-at---tttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||| |||| ||||||||| |||||||| ||| || ||||||||| ||||||||||||| |
|
|
| T |
16083047 |
ggctaaaatatggttttagtccccgcaaatatgtctcgtttttgttttagtctttgtaaaaaaaaatatatatttgtttttagtccctgcaaaat |
16083141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 223 - 318
Target Start/End: Complemental strand, 24510309 - 24510213
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || |||| |||||||| ||| ||||||| ||| | |||||||| ||| |||||||||||| |
|
|
| T |
24510309 |
tggctaaaatatggttttggtccctgcaaatatggttcgttttagttttagtacctagtaaaaaaaaattgttgtttttaatccttgcaaaatattt |
24510213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 224 - 276
Target Start/End: Original strand, 37624746 - 37624798
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtcc |
276 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
37624746 |
ggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttggtcc |
37624798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 224 - 283
Target Start/End: Original strand, 16060596 - 16060654
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||| |||||||||||||| ||||||| |
|
|
| T |
16060596 |
ggctaaaatatggttttggtccct-caaatatgcctcgttttggttttagtcactgtaaa |
16060654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 226 - 305
Target Start/End: Complemental strand, 48730615 - 48730536
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtcc |
305 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||| |||| |||||||||| |||||||| ||| | ||||||||||| |
|
|
| T |
48730615 |
ctaaaatatggttttggtccttgcaaatatgcctcgtttttgttttagtccttgtaaaaaaaaatcgtagtttttggtcc |
48730536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 14007875 - 14007786
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||| |||||||| || | ||||||||||| |||| ||||||||| |||| |||| |||| ||| |||||||||||||||||| |
|
|
| T |
14007875 |
ggctaaaatatagttttagtacccgtaaatatgcctcgttttagttttagtctctgttaaaa-aaaaaattgattttggtccctgcaaaat |
14007786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 15334917 - 15335006
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| || ||| ||||||| ||| ||||||||||| | | |||||||| |||| ||||||||||| |||||||||| |
|
|
| T |
15334917 |
ggctaaaatatggttttaatctctgtaaatatgactcgttttggttttaattcttgtaaaaa-aaaaatttgtttttgggtcctgcaaaat |
15335006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 266
Target Start/End: Complemental strand, 18079660 - 18079618
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttg |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18079660 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 226 - 312
Target Start/End: Complemental strand, 25658299 - 25658214
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||| |||| |||||||||||||||||| ||||| |||||||||||||||||| ||| | ||||| ||||||||||||| |
|
|
| T |
25658299 |
ctaaaatattcttttgatccctgcaaatatgcctcgttttgattttagtccctgtaaaaa-aaattgttgttaatggtccctgcaaa |
25658214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 225 - 279
Target Start/End: Original strand, 32420099 - 32420153
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||| |||||||||||||||||| |
|
|
| T |
32420099 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
32420153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 227 - 314
Target Start/End: Complemental strand, 4324163 - 4324079
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||| ||||||| | |||||||||| ||| ||||||||||| ||| |||||||| |||| |||||||||||| |||||||| |
|
|
| T |
4324163 |
taaaatatgattttagttcatgcaaatatgtctcgttttggttttaatccttgtaaaaaaaaaa---tgtttttggtccgtgcaaaat |
4324079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 265 - 314
Target Start/End: Original strand, 7001622 - 7001671
Alignment:
| Q |
265 |
tggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
7001622 |
tggttttagtccctggtaaaaaaaaattttgtttttggtccctgcaaaat |
7001671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 225 - 266
Target Start/End: Complemental strand, 26142671 - 26142630
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttg |
266 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26142671 |
gctaaaatatggttttaatccctgcaaatatgcctcattttg |
26142630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 285
Target Start/End: Original strand, 33067348 - 33067408
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||| |||||||||| || |||||||||| |
|
|
| T |
33067348 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttggt-cctgtaaaaa |
33067408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 227 - 312
Target Start/End: Complemental strand, 51986571 - 51986488
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||| |||||| |||||||| | |||||| | |||||| |||||||||| ||| | |||||||||||||||||||| |
|
|
| T |
51986571 |
taaaatatggtttttgtccctacaaatatgtcgcattttag-tttagtacctgtaaaaa-aaattgttgtttttggtccctgcaaa |
51986488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 224 - 307
Target Start/End: Complemental strand, 12361369 - 12361290
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta-aaaagaaaattttgtttttggtccct |
307 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||| |||||||||||||||||||| |||| |||| ||||||||||||||| |
|
|
| T |
12361369 |
ggctaaaatatgattttagtccctgca-----gcctcgttttggttttagtccctgtaaaaaaaaaaaaattgtttttggtccct |
12361290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 223 - 279
Target Start/End: Complemental strand, 15211859 - 15211803
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||| ||||||||| | |||||| |
|
|
| T |
15211859 |
tggctaaaatatggttttggtccttgcaaatatgcctcgttttggtttcaatccctg |
15211803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 224 - 284
Target Start/End: Complemental strand, 31061151 - 31061091
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||| |||||||||||||||||| |||| |
|
|
| T |
31061151 |
ggctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtccctgcaaaa |
31061091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 225 - 285
Target Start/End: Complemental strand, 33067729 - 33067669
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||| |||||||||| |||||||||| ||| ||||||||||| | |||||||||| |
|
|
| T |
33067729 |
gctaaaatatcgttttagtccttgcaaatatgtctcgttttggttttaattcctgtaaaaa |
33067669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 223 - 314
Target Start/End: Complemental strand, 33380258 - 33380168
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccc-tgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||| ||| | |||||||||||| ||||||||||||||| ||| |||| |||| | ||||||||||||||||||| |
|
|
| T |
33380258 |
tggctaaaatatggttttagccccctacaaatatgcctcgttttggttttagtcc-tgtgaaaaaaaaaaata-tttttggtccctgcaaaat |
33380168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 224 - 283
Target Start/End: Complemental strand, 4565336 - 4565277
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||| | ||||||||||||||| ||| |||| |||||||||||||||| |
|
|
| T |
4565336 |
ggctaaaatatggttctggtccctgcaaatatgtctcgttttaattttagtccctgtaaa |
4565277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 227 - 282
Target Start/End: Complemental strand, 7350733 - 7350678
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||| ||| |||||||||| |||| ||||||||||||||| ||||| |
|
|
| T |
7350733 |
taaaatatggttttggtcactgcaaatatacctcgttttggttttagtccttgtaa |
7350678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 224 - 283
Target Start/End: Complemental strand, 24978122 - 24978063
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||| ||||| |||| ||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
24978122 |
ggctaaaatatagttttggtcctggcaaatatgcctcgttttggttttagttcctgtaaa |
24978063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 10887306 - 10887348
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10887306 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
10887348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 226 - 272
Target Start/End: Complemental strand, 17130081 - 17130035
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
272 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
17130081 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17130035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 250 - 314
Target Start/End: Original strand, 32453956 - 32454017
Alignment:
| Q |
250 |
aaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||| ||| ||||||||| |||||||||||| |
|
|
| T |
32453956 |
aaatatgtctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttgatccctgcaaaat |
32454017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 265 - 314
Target Start/End: Complemental strand, 37545908 - 37545861
Alignment:
| Q |
265 |
tggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
37545908 |
tggttttagtccctgtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
37545861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 46183757 - 46183799
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46183757 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
46183799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #201
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 265 - 314
Target Start/End: Complemental strand, 32626852 - 32626804
Alignment:
| Q |
265 |
tggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||| |||| || |||||||||||||||||||| |
|
|
| T |
32626852 |
tggttttagtccctgtaaaaaaaaaaatt-gtttttggtccctgcaaaat |
32626804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #202
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 225 - 282
Target Start/End: Complemental strand, 37625026 - 37624969
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || |||||||| ||||| |||||| |
|
|
| T |
37625026 |
gctaaaatatggttttagtccctgtaaatatgtatcgttttggttgtagtctctgtaa |
37624969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #203
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 224 - 281
Target Start/End: Complemental strand, 49923818 - 49923761
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta |
281 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||||| || ||||| |||||||||||||| |
|
|
| T |
49923818 |
ggctaaaatatgattttggtctctgcaaatatgcttcgttttgattttagtccctgta |
49923761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #204
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 240 - 312
Target Start/End: Complemental strand, 50625133 - 50625063
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |||| |||| |||| ||||||||||| |
|
|
| T |
50625133 |
tagtccctgcaaatatctgacattttggttttagtccctgtaaaa--aaaaatttggttttagtccctgcaaa |
50625063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #205
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 282
Target Start/End: Original strand, 12322602 - 12322662
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| || ||||| ||||||||| ||||| |
|
|
| T |
12322602 |
ttggctaaaatatggttttgatccctgcaaatatgtttcgttttgattttagtccttgtaa |
12322662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #206
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 240 - 312
Target Start/End: Original strand, 20061812 - 20061884
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| | ||||| |||| ||||||||||| |
|
|
| T |
20061812 |
tagtccctgcaaatatctgacattttggttttagtccctgtaaaaatatttttttggttttagtccctgcaaa |
20061884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #207
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 262 - 318
Target Start/End: Complemental strand, 32420416 - 32420361
Alignment:
| Q |
262 |
ttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||| |||||||| ||||||||| ||||||||||||||||||| | |||||||||| |
|
|
| T |
32420416 |
ttttgattttagtcgctgtaaaaa-aaaattttgtttttggtccttacaaaatattt |
32420361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #208
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 214 - 282
Target Start/End: Complemental strand, 34383254 - 34383186
Alignment:
| Q |
214 |
gttttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||| ||||||||||||| ||||||| |||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
34383254 |
gttttataatggctaaaatatgattttagttcctgtaaatatgtattgttttggttttagtccctgtaa |
34383186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #209
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 240 - 312
Target Start/End: Original strand, 37172262 - 37172334
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||| | | ||||| |||| |||||| |||| |
|
|
| T |
37172262 |
tagtctctgcaaatatctgtcattttggttttagtccctgtaaaaatatatttttgattttagtcccttcaaa |
37172334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #210
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 227 - 318
Target Start/End: Original strand, 4617091 - 4617182
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| || |||| ||||||||| ||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
4617091 |
taaaatatggttttggtccctgaaaatatgtttcgttttagttttagtctctgtaaatttttgtttttgtttttggtccttgcaaaatattt |
4617182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #211
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 227 - 282
Target Start/End: Original strand, 8364619 - 8364674
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||| |||||||||||||| || |||||||||||||| |||||| |
|
|
| T |
8364619 |
taaaatatggttttgatccctgcaaatatgtttcgttttggttttagtcactgtaa |
8364674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #212
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 224 - 279
Target Start/End: Complemental strand, 8364916 - 8364861
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||| ||||| ||||| ||||||||| ||| |||||||||| ||||||| |
|
|
| T |
8364916 |
ggctaaaatatagttttggtccccgcaaatatgtctcgttttggttttcgtccctg |
8364861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #213
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 224 - 275
Target Start/End: Original strand, 22674203 - 22674254
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
275 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||| |||||||||||||| |
|
|
| T |
22674203 |
ggctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagtc |
22674254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #214
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 224 - 283
Target Start/End: Complemental strand, 26699606 - 26699548
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| || |||| ||||||||| ||||||| |
|
|
| T |
26699606 |
ggctaaaatatggttttggtcc-tgcaaatatgcttcgtttttgttttagtctctgtaaa |
26699548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #215
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 224 - 271
Target Start/End: Complemental strand, 42483271 - 42483224
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggtttt |
271 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| | |||||||||| |
|
|
| T |
42483271 |
ggctaaaatatggttttggtccctgcaaatatgctttgttttggtttt |
42483224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #216
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 237 - 276
Target Start/End: Complemental strand, 44157969 - 44157930
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtcc |
276 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
44157969 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
44157930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #217
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 224 - 295
Target Start/End: Original strand, 47038866 - 47038937
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttg |
295 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| || ||| |||||| ||||||| |||| ||||||||| |
|
|
| T |
47038866 |
ggctaaaatatgtttttagtccctgcaaatatagctagtttgggttttggtccctggtaaaaaaaaattttg |
47038937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #218
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 3247489 - 3247447
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
3247489 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
3247447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #219
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 265 - 314
Target Start/End: Complemental strand, 10552274 - 10552224
Alignment:
| Q |
265 |
tggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
10552274 |
tggttttagtccctgtaaaaaaaaaaaaattgtttttggtccctgcaaaat |
10552224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #220
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 16026865 - 16026823
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
16026865 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
16026823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #221
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 16060668 - 16060710
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
16060668 |
ttttggtccctgcaaatatgcctcattttgattttggtccctg |
16060710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #222
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 19721001 - 19720959
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
19721001 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
19720959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #223
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 24507552 - 24507594
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
24507552 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
24507594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #224
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 242 - 276
Target Start/End: Complemental strand, 25658224 - 25658190
Alignment:
| Q |
242 |
gtccctgcaaatatgcctcattttggttttagtcc |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
25658224 |
gtccctgcaaatatgcctcattttggttttggtcc |
25658190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #225
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 30323220 - 30323178
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
30323220 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
30323178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #226
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 31061078 - 31061036
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
31061078 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
31061036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #227
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 33000596 - 33000554
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
33000596 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
33000554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #228
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 35056821 - 35056779
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
35056821 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
35056779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #229
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 224 - 266
Target Start/End: Original strand, 36912853 - 36912895
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttg |
266 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||| |
|
|
| T |
36912853 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
36912895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #230
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 38136908 - 38136866
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
38136908 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
38136866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #231
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 38150921 - 38150963
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
38150921 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
38150963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #232
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 38164004 - 38164046
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
38164004 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
38164046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #233
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 40718401 - 40718359
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
40718401 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
40718359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #234
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 45380345 - 45380387
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
45380345 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
45380387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #235
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 45638653 - 45638695
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
45638653 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
45638695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #236
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 47819305 - 47819347
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
47819305 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
47819347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #237
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 227 - 281
Target Start/End: Original strand, 48730259 - 48730313
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta |
281 |
Q |
| |
|
|||| |||||||| | ||| ||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
48730259 |
taaagtatggtttgaatccatgcaaatatgcctcattttagttttagtcactgta |
48730313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #238
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 49073980 - 49073938
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
49073980 |
ttttggtccttgcaaatatgcctcattttggttttggtccctg |
49073938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #239
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 242 - 312
Target Start/End: Original strand, 50096149 - 50096219
Alignment:
| Q |
242 |
gtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| | ||||| |||| ||||||||||| |
|
|
| T |
50096149 |
gtccctgcaaatatctgacattttggttttagtccctgtaaaaatatttttttggttttagtccctgcaaa |
50096219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #240
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 278
Target Start/End: Original strand, 24977852 - 24977893
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccct |
278 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
24977852 |
ttttggtccctgcaaatatgtctcattttggttttggtccct |
24977893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #241
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 285
Target Start/End: Complemental strand, 28032016 - 28031971
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28032016 |
tagtccctgcaaatatctgacattttggttttagtccctgtaaaaa |
28031971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #242
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 227 - 276
Target Start/End: Original strand, 39025112 - 39025161
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtcc |
276 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| ||||| |||| |||| |
|
|
| T |
39025112 |
taaaatatggttttggtccctgcaaatatgtctcgttttgattttcgtcc |
39025161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #243
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 256
Target Start/End: Complemental strand, 1811235 - 1811203
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatg |
256 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
1811235 |
ggctaaaatatgattttagtccctgcaaatatg |
1811203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #244
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 256
Target Start/End: Complemental strand, 2604186 - 2604154
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatg |
256 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
2604186 |
ggctaaaatatgtttttagtccctgcaaatatg |
2604154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #245
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 256
Target Start/End: Complemental strand, 32035788 - 32035756
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatg |
256 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
32035788 |
ggctaaaatatggttttggtccctgcaaatatg |
32035756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #246
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 237 - 277
Target Start/End: Original strand, 39747546 - 39747586
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccc |
277 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
39747546 |
ttttggtccctgcaaatatgccttattttggttttggtccc |
39747586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #247
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 252
Target Start/End: Complemental strand, 41881346 - 41881318
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaa |
252 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41881346 |
ggctaaaatatggttttagtccctgcaaa |
41881318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 84; Significance: 7e-40; HSPs: 215)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 223 - 318
Target Start/End: Original strand, 39719352 - 39719447
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39719352 |
tggctaaaatatggttttagtccctacaaatatgcctcattttggttttagtctctgtaaaaagaaaattttgtttttggtccctgcaaaagattt |
39719447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 44402960 - 44403050
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44402960 |
ggctaaaatatggttttagtccctgcaaatatgccccattttggttttagtccctgtaaaaataaaattttgtttttggtccctgcaaaat |
44403050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 19561450 - 19561360
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
19561450 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaagaaaattttgtttttgatcccagcaaaat |
19561360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 45073314 - 45073404
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| ||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45073314 |
ggctaaaatatggttttagtccctgcaaataagcctcgttttggttttaatccctgtaaaaataaaattttgtttttggtccctgcaaaat |
45073404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 39833238 - 39833146
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| | |||| ||||||||||||||||||||||| |
|
|
| T |
39833238 |
ttggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgtaaagaaaaaactttgtttttggtccctgcaaaat |
39833146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 1614904 - 1614810
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
1614904 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattt |
1614810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 6108334 - 6108424
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
6108334 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaat |
6108424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 9659689 - 9659595
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
9659689 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattt |
9659595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 28262713 - 28262807
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
28262713 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctgtaaaaaaaagttgttgtttttggtccctgcaaaatattt |
28262807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 28911577 - 28911667
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
28911577 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaat |
28911667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 41053842 - 41053936
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
41053842 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattt |
41053936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 28911906 - 28911819
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
28911906 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
28911819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 6509470 - 6509382
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
6509470 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
6509382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 10358001 - 10358092
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaa-ttttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||| |||||||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
10358001 |
ggctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaagttttgtttttggtccctgcaaaat |
10358092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 215 - 314
Target Start/End: Complemental strand, 16941061 - 16940962
Alignment:
| Q |
215 |
ttttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||| |||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || | ||||||||||||||| |||||| |
|
|
| T |
16941061 |
ttttattttggataaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaatttgttgtttttggtccctacaaaat |
16940962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 37372904 - 37372816
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
37372904 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacctgtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
37372816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 215 - 313
Target Start/End: Original strand, 44508711 - 44508807
Alignment:
| Q |
215 |
ttttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||| |||||||||||||||||||||| |
|
|
| T |
44508711 |
ttttattttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaa--aaaaatttgtttttggtccctgcaaaa |
44508807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 3975549 - 3975639
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| || | |||||||||||||||||||||| |
|
|
| T |
3975549 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaat |
3975639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 5234204 - 5234110
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| ||| |||||||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
5234204 |
ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
5234110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 5354768 - 5354862
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
5354768 |
ggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattt |
5354862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 8555799 - 8555709
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
8555799 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgtaaaaaacaaaaattgtttttggtccctgcaaaat |
8555709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 222 - 316
Target Start/End: Complemental strand, 16853591 - 16853497
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatat |
316 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| | || | |||||||||||||||||||||||| |
|
|
| T |
16853591 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaataaaatttgttgtttttggtccctgcaaaatat |
16853497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 20388274 - 20388363
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| | ||||||||||||||||||||| |
|
|
| T |
20388274 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaaaaa-aaaaatctgtttttggtccctgcaaaat |
20388363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 35015220 - 35015130
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |||| ||| |||||||||||||||||||||||| |
|
|
| T |
35015220 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaatttttgtttttggtccctgcaaaat |
35015130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 35838337 - 35838243
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| ||| | |||||||| ||||||||||||||||| |
|
|
| T |
35838337 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgttttttgtccctgcaaaatattt |
35838243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 228 - 314
Target Start/End: Original strand, 37372441 - 37372526
Alignment:
| Q |
228 |
aaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaa-aaaactttgtttttggtccctgcaaaat |
37372526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 313
Target Start/End: Complemental strand, 45073641 - 45073554
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
45073641 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaa--ttgtttttggtccctgcaaaa |
45073554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 17999721 - 17999635
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
17999721 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaa----ttgtttttggtccctgcaaaat |
17999635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 6509208 - 6509304
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaa-aatt-ttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| || |||| | |||||||||||||||||||||||| |
|
|
| T |
6509208 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctgtaaaaaaaataattgtagtttttggtccctgcaaaatattt |
6509304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 308
Target Start/End: Complemental strand, 12894402 - 12894318
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctg |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| ||||||||||| |||| |
|
|
| T |
12894402 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggttcctg |
12894318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 225 - 314
Target Start/End: Original strand, 6079810 - 6079896
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
6079810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
6079896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 223 - 314
Target Start/End: Complemental strand, 10358369 - 10358278
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| ||| ||| |||||||||||||||||| |
|
|
| T |
10358369 |
tggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaagaattgattttggtccctgcaaaat |
10358278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 217 - 314
Target Start/End: Original strand, 21554386 - 21554480
Alignment:
| Q |
217 |
ttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||| ||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
21554386 |
ttatgttggctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagtccttgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
21554480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 224 - 311
Target Start/End: Original strand, 23816670 - 23816757
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaa |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||||||| |||| ||||||||||||||||||| |
|
|
| T |
23816670 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtctctgtaaaaaaaaaaaattgtttttggtccctgcaa |
23816757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 223 - 318
Target Start/End: Original strand, 27037592 - 27037687
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||| ||||| || | |||||||||||||||||||||||||| |
|
|
| T |
27037592 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattt |
27037687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 219 - 318
Target Start/End: Complemental strand, 29198667 - 29198568
Alignment:
| Q |
219 |
atgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| | | |||||||||||||||||||||||||| |
|
|
| T |
29198667 |
atgtaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattt |
29198568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 224 - 313
Target Start/End: Complemental strand, 44344789 - 44344703
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
44344789 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaa |
44344703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 222 - 314
Target Start/End: Original strand, 1006833 - 1006924
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||| ||||||||||||||| |||||| |
|
|
| T |
1006833 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctacaaaat |
1006924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 1559343 - 1559433
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||||| ||||| ||||||| |||| || ||||||||||||||||||||||||| |
|
|
| T |
1559343 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttaatccctgttaaaaaaacattttgtttttggtccctgcaaaat |
1559433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 5308686 - 5308598
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||| |||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
5308686 |
ggctaaaatatg-ttttagtccctgcaaatatacctcgttttggttttagtccctgtaaaaa-aaaaatttgtttttggtccctgcaaaat |
5308598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 11767275 - 11767181
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| || | || ||||||||||||| ||||||||| |
|
|
| T |
11767275 |
ggctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtccctgtaaaaaaaatttgttatttttggtccctgaaaaatattt |
11767181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 18022704 - 18022614
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||||||||| |||||||| || | |||||||||||||||||||||| |
|
|
| T |
18022704 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaataaattgtttttggtccctgcaaaat |
18022614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 19465980 - 19465891
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||| ||| ||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
19465980 |
ggctaaaatatggttttag-ccctgcaaatatgtctcgtttcggttttagtccctgtaaaaagaaaaatttgtttttggtccctacaaaat |
19465891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 21554753 - 21554664
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
21554753 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctgtaaaaa-aaaaaattgtttttggtccctgcaaaat |
21554664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 23676452 - 23676362
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||||| |
|
|
| T |
23676452 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaat |
23676362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 25092548 - 25092454
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| | | |||||||||||||||||||||||||| |
|
|
| T |
25092548 |
ggctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattt |
25092454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 217 - 314
Target Start/End: Complemental strand, 25547497 - 25547402
Alignment:
| Q |
217 |
ttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||||||| |||| ||||||||||||| |||||||| |
|
|
| T |
25547497 |
ttattttggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaaaa--ttgtttttggtccttgcaaaat |
25547402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 222 - 314
Target Start/End: Original strand, 31732099 - 31732188
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
31732099 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccctgtaaaaaaaaaa---tgtttttggtccctgcaaaat |
31732188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 48192488 - 48192394
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| || | |||||| ||||||||||||||||||| |
|
|
| T |
48192488 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttctggtccctgcaaaatattt |
48192394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 222 - 314
Target Start/End: Original strand, 7431949 - 7432041
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |||| |||| |||||||||||||||||||||| |
|
|
| T |
7431949 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtctttggtaaaaaaaaaaattgtttttggtccctgcaaaat |
7432041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 8144658 - 8144570
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
8144658 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
8144570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 19783815 - 19783902
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||| ||||||||||||||| |||||||| |||| ||||||||||||||||||||| |
|
|
| T |
19783815 |
ggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtccttgtaaaaa-aaaaatttgtttttggtccctgcaaa |
19783902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 23399612 - 23399700
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
23399612 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
23399700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 27458399 - 27458487
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| || | |||||||||||||||||||| |
|
|
| T |
27458399 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaacttgttgtttttggtccctgcaaa |
27458487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 35470280 - 35470192
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| | |||||||| ||||||||||| |
|
|
| T |
35470280 |
ggctaaaatttggttttgatccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaattattgttttttgtccctgcaaa |
35470192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 1559705 - 1559617
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |||| ||||||||||||| |||||||| |
|
|
| T |
1559705 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccctgtaaaaaaaaaa--ttgtttttggtccttgcaaaat |
1559617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 223 - 314
Target Start/End: Original strand, 1974008 - 1974095
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
1974008 |
tggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaa----aaaaatttgtttttggtccctgcaaaat |
1974095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 12932783 - 12932690
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| ||||| |||||||||||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
12932783 |
ggctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtccctgtaaaaa-aatttgttgtttttggtccctgcaaaatattt |
12932690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 222 - 314
Target Start/End: Original strand, 13769772 - 13769861
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |||||||| ||| ||||||||||||| |||||||| |
|
|
| T |
13769772 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaaaaaaaaa---ttgtttttggtccttgcaaaat |
13769861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 39832906 - 39832991
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| ||| ||||||||||||||| |||| |
|
|
| T |
39832906 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccctacaaa |
39832991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 45021856 - 45021766
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| | || |||| ||| |||||||||||||||||||||| |
|
|
| T |
45021856 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagttcatggtaaaaaaaataattgtttttggtccctgcaaaat |
45021766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 222 - 318
Target Start/End: Original strand, 5308321 - 5308418
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt-aaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||| |||| |||||||||||||| ||||| |||| |||||||||| ||||||||||| |||| |
|
|
| T |
5308321 |
ttggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgtaaaaaaaaaaaatttgtttttgatccctgcaaaaaattt |
5308418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 46304386 - 46304293
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta-aaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| || |||||||||||||||||||| |||| |||| ||||||||| ||||||||||||| |
|
|
| T |
46304386 |
ttggctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaaaaatttgttttttgtccctgcaaaat |
46304293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 3975838 - 3975751
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||| |||||||||| || | |||||||||||||||||||| |
|
|
| T |
3975838 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt-cctgtaaaaaaaatttgttgtttttggtccctgcaaa |
3975751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 25092160 - 25092248
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
25092160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
25092248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 25988749 - 25988661
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| || || || | |||||||||||||||||||| |
|
|
| T |
25988749 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaacaaaaatttgttgtttttggtccctgcaaa |
25988661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 308
Target Start/End: Complemental strand, 26878071 - 26877987
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctg |
308 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||| |
|
|
| T |
26878071 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctg |
26877987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 227 - 314
Target Start/End: Original strand, 30709328 - 30709413
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||| ||||||||||||||| |||||||| |||| |||||||||||||||||||||| |
|
|
| T |
30709328 |
taaaatatgattttagtccctacaaatatgcctcgttttggttttagtccttgtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
30709413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 222 - 313
Target Start/End: Complemental strand, 44403251 - 44403162
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||| ||||||||||||||||| |||||| |||| |||||||||||| |||||||| |
|
|
| T |
44403251 |
ttggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctataaaaaaaaaa--ttgtttttggtcactgcaaaa |
44403162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 223 - 314
Target Start/End: Original strand, 45021493 - 45021585
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcatttt-ggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |||| ||| |||||||||| |||||||||||| |
|
|
| T |
45021493 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtccctgctaaaaaaaacatttgtttttgctccctgcaaaat |
45021585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 224 - 291
Target Start/End: Original strand, 17999465 - 17999532
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaat |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| ||||| |
|
|
| T |
17999465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttcgtccctgtaaaaacaaaat |
17999532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 224 - 283
Target Start/End: Original strand, 19757748 - 19757807
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19757748 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
19757807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 227 - 318
Target Start/End: Complemental strand, 39520727 - 39520636
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||| ||||| |||||||||||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
39520727 |
taaaatatggttttggtccttgcaaatatgtctcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattt |
39520636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 225 - 314
Target Start/End: Original strand, 18022368 - 18022455
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||| ||||||||||||| ||| |||||| |||| |||||||||||||||||||||| |
|
|
| T |
18022368 |
gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagttcctataaaaaaaaaa--ttgtttttggtccctgcaaaat |
18022455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 31310365 - 31310454
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||| |||||||||||||| ||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
31310365 |
ggctaaaatatgattttagtccctgcaaatatttctcgttttggttttagtctctgtaaaaa-aaaaaattgtttttggtccctgcaaaat |
31310454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 41054236 - 41054178
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41054236 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
41054178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 48359077 - 48358988
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||| | |||||||| ||| ||||||||| |||||||||||| |
|
|
| T |
48359077 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcttgtaaaaaaaaa---ttgtttttgatccctgcaaaat |
48358988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 48854070 - 48853976
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| || |||||||||||||||||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
48854070 |
ggctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattt |
48853976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 223 - 314
Target Start/End: Complemental strand, 1007230 - 1007140
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||| ||||||||| | ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
1007230 |
tggctaaaatatggttttagtccctccaaatatgcctcgttttgattttagtccttggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
1007140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 224 - 304
Target Start/End: Complemental strand, 13770081 - 13770003
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtc |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||||||| ||||||||| |||| ||||||||||||| |
|
|
| T |
13770081 |
ggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcctgtaaaa--aaaaatttgtttttggtc |
13770003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 223 - 314
Target Start/End: Original strand, 19561153 - 19561237
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| | || |||||||||||||||||||||||||||| |
|
|
| T |
19561153 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttc-------aaaaaaattttgtttttggtccctgcaaaat |
19561237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 239 - 314
Target Start/End: Complemental strand, 19758044 - 19757972
Alignment:
| Q |
239 |
ttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||||| |
|
|
| T |
19758044 |
ttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaa---ttgtttttggtccgtgcaaaat |
19757972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 245 - 318
Target Start/End: Complemental strand, 27458698 - 27458625
Alignment:
| Q |
245 |
cctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
27458698 |
cctgcaaatatgcctcgttttagttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
27458625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 224 - 285
Target Start/End: Complemental strand, 35210515 - 35210454
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
35210515 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaa |
35210454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 224 - 292
Target Start/End: Complemental strand, 44509054 - 44508985
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaatt |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||||| |
|
|
| T |
44509054 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatt |
44508985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 227 - 312
Target Start/End: Original strand, 48192260 - 48192345
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| | | |||||||||||||||||||| |
|
|
| T |
48192260 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
48192345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 5233808 - 5233896
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| || |||||||||||||||||| ||||| | | |||||||||||||||||||| |
|
|
| T |
5233808 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
5233896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 227 - 318
Target Start/End: Complemental strand, 6589271 - 6589182
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||| ||||||| ||| | |||||||||||||||| ||||||||| |
|
|
| T |
6589271 |
taaaatatggttttggtccctgcaaatatgccttgttttggttttagtccatgtaaaa--aaattgttgtttttggtccctgtaaaatattt |
6589182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 9659355 - 9659443
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| ||||| |||||||||||| |||||||| | |||||||||||||||||||| |
|
|
| T |
9659355 |
ggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgcaaaaagaatttgttgtttttggtccctgcaaa |
9659443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 239 - 314
Target Start/End: Original strand, 12894056 - 12894129
Alignment:
| Q |
239 |
ttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
12894056 |
ttagtccctgcaaatatgcctcgttttggttttaatccctgtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
12894129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 227 - 314
Target Start/End: Original strand, 14738603 - 14738688
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |||| |||||||||||||| |||||||| |
|
|
| T |
14738603 |
taaaatattattttagtccctgcaaatatgcctcattttggttttagtcctggtaaaa--aaaaatttgtttttggtccttgcaaaat |
14738688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 16940762 - 16940850
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||| ||||||||||||||||||||||| || | ||||||||||||| |||||| |
|
|
| T |
16940762 |
ggctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtccctgtaaaaaacaattgttgtttttggtccttgcaaa |
16940850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 226 - 282
Target Start/End: Original strand, 17854151 - 17854207
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17854151 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgtaa |
17854207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 223 - 315
Target Start/End: Complemental strand, 24717533 - 24717441
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaata |
315 |
Q |
| |
|
|||||||||||||||||| |||||| | |||||| ||| ||||||||||||||||| |||||| ||| | ||||||||||||||| ||||||| |
|
|
| T |
24717533 |
tggctaaaatatggttttggtccctaccaatatgtctcgttttggttttagtccctataaaaaaaaattgttgtttttggtccctacaaaata |
24717441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 226 - 290
Target Start/End: Complemental strand, 32189388 - 32189324
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaa |
290 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
32189388 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaa |
32189324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 308
Target Start/End: Original strand, 35837924 - 35838008
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctg |
308 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||| |||||||| || | |||||||||||||||| |
|
|
| T |
35837924 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaaaaaaaatttgttgtttttggtccctg |
35838008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 39439029 - 39438941
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||| | ||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
39439029 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
39438941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 44568326 - 44568414
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
44568326 |
ggctaaaatatggttttggtccctgcaaatataactcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
44568414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 308
Target Start/End: Complemental strand, 46759942 - 46759858
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctg |
308 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||||||||||||||||||||||| || | |||||||||||||||| |
|
|
| T |
46759942 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctg |
46759858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 23817034 - 23816946
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||| ||| ||||||| ||||| |||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
23817034 |
ggctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagttcctgtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
23816946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 224 - 295
Target Start/End: Complemental strand, 39719642 - 39719571
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttg |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||| ||||||||||||||||| | ||||||||| |
|
|
| T |
39719642 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtccctgtaaacaaaaaattttg |
39719571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 224 - 283
Target Start/End: Complemental strand, 45228918 - 45228859
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
45228918 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
45228859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 224 - 310
Target Start/End: Complemental strand, 46648715 - 46648631
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgca |
310 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||||||| ||| ||||||| |||| |||||||||||||| |||| |
|
|
| T |
46648715 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttaatccttgtaaaa--aaaaatttgtttttggtccttgca |
46648631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 3807864 - 3807958
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||| ||||| || |||||||||||| ||| ||||||||||||| ||||||||||||| | ||||||||| ||| |||||||||||| |
|
|
| T |
3807864 |
ggctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagttcctgtaaaaagaatttgttgtttttgatccttgcaaaatattt |
3807958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 8144295 - 8144389
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |||| | |||||||||||||||||||||||||| |
|
|
| T |
8144295 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattt |
8144389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 290
Target Start/End: Complemental strand, 21223748 - 21223682
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaa |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |||||| |||| |
|
|
| T |
21223748 |
ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctataaaaaaaaaa |
21223682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 227 - 312
Target Start/End: Complemental strand, 31503780 - 31503695
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||| |||||||| |||| |||||||| || |||||||||||||||||||| |
|
|
| T |
31503780 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtctctgt-aaaagaaatttgttgtttttggtccctgcaaa |
31503695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 489072 - 488986
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| ||| ||||| |||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
489072 |
ggctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaa----ttgtttttggtccctgcaaaat |
488986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 224 - 285
Target Start/End: Original strand, 14543710 - 14543771
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
14543710 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccatgtaaaaa |
14543771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 14739004 - 14738918
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||| |||||||||||| |||| |||| ||||||||||||| |||||| |
|
|
| T |
14739004 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctggtaaaaaaaaa--ttgtttttggtccttgcaaa |
14738918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 227 - 312
Target Start/End: Original strand, 23676135 - 23676220
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| |||||||||||||||||| ||||| | | |||||||||||||||||||| |
|
|
| T |
23676135 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
23676220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 223 - 313
Target Start/End: Complemental strand, 30352905 - 30352817
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||| ||||||||||| ||||||| |||| ||||||||||||||||||| |
|
|
| T |
30352905 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaa---agtttttggtccctgcaaaa |
30352817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 225 - 314
Target Start/End: Complemental strand, 41365213 - 41365125
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||| ||||||||||||| ||||||||| |||| ||||||||||||| |||||||| |
|
|
| T |
41365213 |
gctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagtttctgtaaaaa-aaaaaattgtttttggtccttgcaaaat |
41365125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 30223461 - 30223549
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||| ||| |||||||||||||||||| ||||| || | || ||||||||||||||||| |
|
|
| T |
30223461 |
ggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctgcaaaaaaaatttgttatttttggtccctgcaaa |
30223549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 224 - 284
Target Start/End: Complemental strand, 35104295 - 35104235
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35104295 |
ggctcaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaa |
35104235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 39520398 - 39520486
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| |||| | |||||||| ||| |||||||||||||||||||||||| || | ||||||||||||||| |||| |
|
|
| T |
39520398 |
ggctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctccaaa |
39520486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 224 - 308
Target Start/End: Original strand, 45228615 - 45228699
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctg |
308 |
Q |
| |
|
||||||||||||||||| | ||| ||||||||||||| |||| ||||||||||||| ||||| ||| | |||||||||||||||| |
|
|
| T |
45228615 |
ggctaaaatatggttttgggccccgcaaatatgcctcgtttttgttttagtccctgcaaaaaaaaattgttgtttttggtccctg |
45228699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 225 - 312
Target Start/End: Original strand, 18311581 - 18311667
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||| ||||||||||| || ||||||||| |||| ||||||||| |||||||||| |
|
|
| T |
18311581 |
gctaaaatatggttttagtctctacaaatatgcctcgttttggttttattctctgtaaaaa-aaaaaattgtttttgatccctgcaaa |
18311667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 21223405 - 21223496
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt-aaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| || |||||||||||||| |||| ||||| |||| ||||||||||| ||| |||||| |
|
|
| T |
21223405 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtctctgtaaaaaaaaaaaaattgtttttggttcctacaaaat |
21223496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 226 - 285
Target Start/End: Original strand, 37952671 - 37952730
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||||||||||||| ||||||| || ||||||||||||||||||||||||| |
|
|
| T |
37952671 |
ctaaaatatggttttagtccctgtaaatatgtcttattttggttttagtccctgtaaaaa |
37952730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 282
Target Start/End: Complemental strand, 46829313 - 46829254
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
46829313 |
tggctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtccctgtaa |
46829254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 222 - 292
Target Start/End: Complemental strand, 18927093 - 18927023
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt |
292 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||| ||||||||| |||||||| |||||| |
|
|
| T |
18927093 |
ttggctaaaatatagttttagtccctgcaaatatgtctcattttagttttagtcattgtaaaaaaaaaatt |
18927023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 223 - 300
Target Start/End: Complemental strand, 20388676 - 20388598
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt-aaaaagaaaattttgttttt |
300 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||| ||||| ||||||| ||||| ||||| |||||||||||||| |
|
|
| T |
20388676 |
tggctaaaatatggttttagtcgctgaaaatatgcctcgttttgattttagttcctgtaaaaaaaaaaattttgttttt |
20388598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 23399976 - 23399882
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
23399976 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattt |
23399882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 25988385 - 25988479
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
25988385 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattt |
25988479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 30223795 - 30223701
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||| ||||||||||||||| |||||| | |||||||||||||||||||||||||| |
|
|
| T |
30223795 |
ggctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtccttgtaaattttttttgttgtttttggtccctgcaaaatattt |
30223701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 31732451 - 31732362
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||| |||||| || |||||||| |||| |||||||||| |||||||||| |
|
|
| T |
31732451 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagcccttgtaaaaa-aaaaaaatgtttttggttcctgcaaaat |
31732362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 41364884 - 41364973
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| || || |||||||| ||| ||||||||||||||||||| |||| || | |||||||||||| |||||||||| |
|
|
| T |
41364884 |
ggctaaaatatggttttaatctctacaaatatgtctcgttttggttttagtccctgtgaaaaaaataatttgtttttggt-cctgcaaaat |
41364973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 227 - 312
Target Start/End: Complemental strand, 5355114 - 5355030
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||| |||||||||||||| |||||||| || | |||||||||||||||||||| |
|
|
| T |
5355114 |
taaagtatggttttggtccctgcaaatatgcctcgttttggttttagtcattgtaaaaa-aatttgttgtttttggtccctgcaaa |
5355030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 226 - 307
Target Start/End: Complemental strand, 6847117 - 6847036
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccct |
307 |
Q |
| |
|
||||||||||||||| |||||||||||||||| || |||||||||||||| ||||||||| | | | ||||||||| ||||| |
|
|
| T |
6847117 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtctctgtaaaaaaatattgttgtttttgatccct |
6847036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 224 - 281
Target Start/End: Original strand, 35665877 - 35665934
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta |
281 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
35665877 |
ggctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtccctgta |
35665934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 230 - 314
Target Start/End: Original strand, 488720 - 488802
Alignment:
| Q |
230 |
aatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||| |||||||||| ||| |||||| |||||||| |||||||| |||| |||||||||||||||||||||| |
|
|
| T |
488720 |
aatatggttttagtccttgcaaatatgtctcgttttgg-tttagtccttgtaaaaa-aaaaaattgtttttggtccctgcaaaat |
488802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 224 - 284
Target Start/End: Original strand, 1614559 - 1614619
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |||| |
|
|
| T |
1614559 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaa |
1614619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 26877678 - 26877766
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| || ||||||||||| ||| |||||||||||||||||| ||||| | | |||||||||||||||||||| |
|
|
| T |
26877678 |
ggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
26877766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 227 - 279
Target Start/End: Original strand, 30352563 - 30352615
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
30352563 |
taaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtccctg |
30352615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 233 - 284
Target Start/End: Complemental strand, 1271590 - 1271539
Alignment:
| Q |
233 |
atggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1271590 |
atggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaa |
1271539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 223 - 318
Target Start/End: Original strand, 35469879 - 35469974
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || |||||||||||||| |||||||| | |||||||||||||||||||||||||| |
|
|
| T |
35469879 |
tggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtctctgtaaaatttttttgttgtttttggtccctgcaaaatattt |
35469974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 226 - 314
Target Start/End: Original strand, 43058752 - 43058836
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||| ||||||||||||||||||||| || ||||| |||||||||||||||||| || ||||||||||||| |||||||| |
|
|
| T |
43058752 |
ctaaaatatagttttagtccctgcaaatatgtcttgttttgattttagtccctgtaaaaaaaa----ttgtttttggtccttgcaaaat |
43058836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 224 - 283
Target Start/End: Original strand, 46759658 - 46759717
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||| |||||| |
|
|
| T |
46759658 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaaa |
46759717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 224 - 283
Target Start/End: Original strand, 48852444 - 48852503
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||| |||||||||| |||||| |
|
|
| T |
48852444 |
ggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccttgtaaa |
48852503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 2945845 - 2945787
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
2945845 |
ggctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtccctgtaa |
2945787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 276
Target Start/End: Original strand, 6589019 - 6589073
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtcc |
276 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||| |||| |
|
|
| T |
6589019 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtcc |
6589073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 227 - 285
Target Start/End: Original strand, 11766920 - 11766978
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||| |||||| |||||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttcgtccctataaaaa |
11766978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 39438741 - 39438830
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||| ||||||||||||| | |||||||| | | ||||||||||||| |||||||| |
|
|
| T |
39438741 |
ggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagt-cttgtaaaaaaattttgttgtttttggtccttgcaaaat |
39438830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 44568690 - 44568596
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
44568690 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattt |
44568596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 290
Target Start/End: Original strand, 46304086 - 46304152
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaa |
290 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||| ||||||||||||||| | |||||| |||| |
|
|
| T |
46304086 |
ggctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagtccttataaaaaaaaaa |
46304152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 46828944 - 46829002
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
46828944 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgtaa |
46829002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 237 - 282
Target Start/End: Complemental strand, 41054163 - 41054118
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41054163 |
ttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
41054118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 224 - 280
Target Start/End: Original strand, 22539930 - 22539986
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt |
280 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
22539930 |
ggctaaaatatggttttgatccctccaaatatgcctcattttggttttagttcctgt |
22539986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 224 - 284
Target Start/End: Original strand, 29198303 - 29198363
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||||||| |||| |
|
|
| T |
29198303 |
ggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctgcaaaa |
29198363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 224 - 284
Target Start/End: Complemental strand, 30709644 - 30709584
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||| ||| |||| |
|
|
| T |
30709644 |
ggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtctctgcaaaa |
30709584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 227 - 283
Target Start/End: Original strand, 38186369 - 38186425
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||| |||||| ||||||||| |
|
|
| T |
38186369 |
taaaatatggttttggtccctgcaaatatgcctcgttttgattttaggccctgtaaa |
38186425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 227 - 274
Target Start/End: Original strand, 25547256 - 25547303
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
274 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
25547256 |
taaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
25547303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 225 - 276
Target Start/End: Original strand, 43300613 - 43300664
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtcc |
276 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||| ||||||||||||||| |
|
|
| T |
43300613 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtcc |
43300664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 227 - 282
Target Start/End: Original strand, 44841359 - 44841414
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
44841359 |
taaaatatggttttgatccctgcaaatatgcctcgttttgattttagtccctgtaa |
44841414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 224 - 283
Target Start/End: Complemental strand, 44958506 - 44958447
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
44958506 |
ggctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtccctgtaaa |
44958447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 227 - 301
Target Start/End: Complemental strand, 7432249 - 7432175
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttg |
301 |
Q |
| |
|
||||||||||||||| | |||||||||||||||| ||||| |||||||| ||| |||| |||| |||||||||| |
|
|
| T |
7432249 |
taaaatatggttttaattcctgcaaatatgcctcgttttgattttagtctctggtaaaaaaaaaatttgtttttg |
7432175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 270
Target Start/End: Complemental strand, 31310679 - 31310633
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
31310679 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 222 - 272
Target Start/End: Original strand, 32189074 - 32189124
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
272 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| || ||||||||||| |
|
|
| T |
32189074 |
ttggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
32189124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 38486478 - 38486572
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||| ||| |||| |||||||| ||| ||||| || | | |||||||||||||||||||||||| |
|
|
| T |
38486478 |
ggctaaaatatgattttggtccctgtaaatatgtctcgttttagttttagttcctctaaaacaaatttgtcgtttttggtccctgcaaaatattt |
38486572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 215 - 272
Target Start/End: Complemental strand, 6911256 - 6911199
Alignment:
| Q |
215 |
ttttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
272 |
Q |
| |
|
|||||| ||||||||||||||||||| || ||||||||||| |||| ||||||||||| |
|
|
| T |
6911256 |
ttttattttggctaaaatatggttttggttcctgcaaatatacctcgttttggtttta |
6911199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 226 - 318
Target Start/End: Complemental strand, 18311938 - 18311849
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||| ||||| ||||| ||||||||||| ||||| ||||||||| ||| ||||||||| ||||||||| ||||||||||| |||| |
|
|
| T |
18311938 |
ctaaaatatgattttaatccctctaaatatgcctcgttttgattttagtccttgt-aaaagaaaa--ttgtttttgatccctgcaaaaaattt |
18311849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 225 - 282
Target Start/End: Complemental strand, 37527421 - 37527364
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
37527421 |
gctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtccctgtaa |
37527364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 227 - 283
Target Start/End: Original strand, 45671217 - 45671273
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| |||| |||||||| |||||||| |
|
|
| T |
45671217 |
taaaatatggttttagtccatgcaaatatgtctcgttttagttttagttcctgtaaa |
45671273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 226 - 285
Target Start/End: Original strand, 18926889 - 18926948
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||||||||| | | |||||||| ||| ||||||||| |||||||||||||| |
|
|
| T |
18926889 |
ctaaaatatggttttagttcattcaaatatgactcgttttggtttaagtccctgtaaaaa |
18926948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 232 - 283
Target Start/End: Original strand, 24953828 - 24953879
Alignment:
| Q |
232 |
tatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||| |||||| |
|
|
| T |
24953828 |
tatggttttagtccctgcaaatatgcattgttttggttttagtccatgtaaa |
24953879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 227 - 282
Target Start/End: Original strand, 31503423 - 31503478
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||| | ||||| ||||||| ||| ||||||||||||||||||||| |
|
|
| T |
31503423 |
taaaatatggttttggcccctgtaaatatgtctctttttggttttagtccctgtaa |
31503478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 227 - 278
Target Start/End: Original strand, 34877777 - 34877828
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct |
278 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| ||| ||||||||||||||||| |
|
|
| T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccct |
34877828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 224 - 283
Target Start/End: Complemental strand, 34878125 - 34878066
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| ||||||||||| || ||||||| |
|
|
| T |
34878125 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttaatctctgtaaa |
34878066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 224 - 279
Target Start/End: Original strand, 35104078 - 35104133
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
35104078 |
ggctaaaatataattttggtccctgcaaatatgtctcgttttggttttagtccctg |
35104133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 3975766 - 3975724
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3975766 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
3975724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 6892260 - 6892202
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||| || |||||| |||||||||||||| |
|
|
| T |
6892260 |
ggctaaaatatggttttggtccctgcaaaaatgtcttgttttgggtttagtccctgtaa |
6892202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 9659428 - 9659470
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9659428 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
9659470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 27458472 - 27458514
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27458472 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
27458514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 28528905 - 28528963
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| || |||| ||||||| ||| ||| ||||||||||||||||| |
|
|
| T |
28528905 |
ggctaaaatatggttttggttcctgtaaatatgtctcgtttgggttttagtccctgtaa |
28528963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 290
Target Start/End: Original strand, 35210182 - 35210248
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaa |
290 |
Q |
| |
|
|||||||||||| |||| |||| ||||||||| ||| ||||||||||||||||||| |||| |||| |
|
|
| T |
35210182 |
ggctaaaatatgattttgatcccggcaaatatgactcgttttggttttagtccctgttaaaaaaaaa |
35210248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 35470207 - 35470165
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35470207 |
tttttgtccctgcaaatatgcctcattttggttttggtccctg |
35470165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 227 - 285
Target Start/End: Complemental strand, 37953048 - 37952990
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||||||||||||| ||||||| || |||||||||||||| || |||||| |
|
|
| T |
37953048 |
taaaatatggttttagtccctgtaaatatgtcttgttttggttttagtctctataaaaa |
37952990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 41054103 - 41054061
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41054103 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
41054061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 228 - 281
Target Start/End: Original strand, 6954862 - 6954915
Alignment:
| Q |
228 |
aaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta |
281 |
Q |
| |
|
||||||||||||| |||||||||||||| ||| |||||||||||||| ||||| |
|
|
| T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggttttagtctctgta |
6954915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #181
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 222 - 275
Target Start/End: Complemental strand, 18891567 - 18891514
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
275 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||| |||| |||||||| |
|
|
| T |
18891567 |
ttggttaaaatatggttttagtccctgcaaatatgtctcgttttaattttagtc |
18891514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #182
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 227 - 292
Target Start/End: Complemental strand, 45671545 - 45671480
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt |
292 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||| |||| |||||||||||| ||||| |||||| |
|
|
| T |
45671545 |
taaaatatggttttagtcattgcaaatatgtctcgttttagttttagtccctaaaaaaaaaaaatt |
45671480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #183
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 265 - 314
Target Start/End: Original strand, 46648453 - 46648502
Alignment:
| Q |
265 |
tggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||| |||||||| |
|
|
| T |
46648453 |
tggttttagtccctgtaaaaaaaaaaaattgtttttggtccttgcaaaat |
46648502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #184
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 265 - 314
Target Start/End: Original strand, 19465661 - 19465707
Alignment:
| Q |
265 |
tggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
19465661 |
tggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
19465707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #185
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 224 - 275
Target Start/End: Complemental strand, 38486790 - 38486739
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
275 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||| | |||||||||||||| |
|
|
| T |
38486790 |
ggctaaaatatggttttgatccctgtaaatatgccccgttttggttttagtc |
38486739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #186
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 224 - 283
Target Start/End: Original strand, 44344457 - 44344516
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||||||||||||||| || ||||||||| ||| ||| ||||||| ||| |||||| |
|
|
| T |
44344457 |
ggctaaaatatggttttagttcccgcaaatatgtctcgtttcggttttaatccttgtaaa |
44344516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #187
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 265 - 314
Target Start/End: Original strand, 48358833 - 48358879
Alignment:
| Q |
265 |
tggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
48358833 |
tggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
48358879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #188
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 5355045 - 5355003
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
5355045 |
ttttggtccctgcaaatatgcttcattttggttttggtccctg |
5355003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #189
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 6891967 - 6892009
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
6891967 |
ttttggtctctgcaaatatgcctcattttggttttggtccctg |
6892009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #190
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 16940835 - 16940877
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
16940835 |
ttttggtccttgcaaatatgcctcattttggttttggtccctg |
16940877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #191
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 226 - 284
Target Start/End: Original strand, 21488335 - 21488393
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
||||||||||||||| ||||||||||| | | ||||||| |||||||||| ||||||| |
|
|
| T |
21488335 |
ctaaaatatggttttgatccctgcaaatttacttcattttagttttagtccatgtaaaa |
21488393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #192
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 23399685 - 23399727
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
23399685 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
23399727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #193
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 23676205 - 23676247
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
23676205 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
23676247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #194
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 222 - 279
Target Start/End: Original strand, 24717225 - 24717283
Alignment:
| Q |
222 |
ttggctaaaatatgg-ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||| |||| ||||||| ||||||| ||||||||| |||| ||||||| |
|
|
| T |
24717225 |
ttggctaaaatatggtttttggtccctgtaaatatgtctcattttgattttggtccctg |
24717283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #195
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 25092233 - 25092275
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
25092233 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
25092275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #196
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 25988676 - 25988634
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
25988676 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
25988634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #197
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 26877751 - 26877793
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
26877751 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
26877793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #198
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 27037860 - 27037818
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
27037860 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
27037818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #199
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 29198376 - 29198418
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
29198376 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
29198418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #200
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 44568399 - 44568441
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
44568399 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
44568441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #201
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 48852517 - 48852559
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
48852517 |
ttttggtccctgcaaatatgcctcattttgattttggtccctg |
48852559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #202
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 215 - 312
Target Start/End: Original strand, 24345 - 24442
Alignment:
| Q |
215 |
ttttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||| |||||| ||||||| ||||||| |||||||| |||||||||||||||||||||||||| | ||||| |||| ||||||||||| |
|
|
| T |
24345 |
ttttattttggcttaaatatgaaaatagtcccggcaaatatctgacattttggttttagtccctgtaaaaatatttttttggttttagtccctgcaaa |
24442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #203
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 278
Target Start/End: Original strand, 1614632 - 1614673
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccct |
278 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
1614632 |
ttttggtccctgcaaatatgtctcattttggttttggtccct |
1614673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #204
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 285
Target Start/End: Complemental strand, 19158062 - 19158017
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19158062 |
tagtccctgcaaatatctgacattttggttttagtccctgtaaaaa |
19158017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #205
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 285
Target Start/End: Complemental strand, 20757461 - 20757416
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
20757461 |
tagtccctgcaaatatctgacattttggttttagtccctgtaaaaa |
20757416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #206
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 265 - 313
Target Start/End: Complemental strand, 22871276 - 22871230
Alignment:
| Q |
265 |
tggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
||||||||||| ||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
22871276 |
tggttttagtctctgtaaaaaaaaa--tttgtttttggtccctgcaaaa |
22871230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #207
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 222 - 271
Target Start/End: Complemental strand, 28529211 - 28529162
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggtttt |
271 |
Q |
| |
|
|||| |||||||||||||| ||| ||||||||||| ||| |||||||||| |
|
|
| T |
28529211 |
ttggttaaaatatggttttggtctctgcaaatatgtctcgttttggtttt |
28529162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #208
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 242 - 314
Target Start/End: Original strand, 11324071 - 11324143
Alignment:
| Q |
242 |
gtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||| | | || ||||| ||||||||||||| |||| ||||||||| |||||||||||| |
|
|
| T |
11324071 |
gtccctgcaaatatggcccgattaagttttcgtccctgtaaaaaaaaaaaattgtttttgatccctgcaaaat |
11324143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #209
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 226 - 282
Target Start/End: Complemental strand, 28263069 - 28263013
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||| |||||||||||||| | ||||| ||||||||||||||| |
|
|
| T |
28263069 |
ctaaaatatggttttgatccctgcaaatatgtattgttttgattttagtccctgtaa |
28263013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #210
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 252
Target Start/End: Original strand, 35014928 - 35014956
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaa |
252 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35014928 |
ggctaaaatatggttttagtccctgcaaa |
35014956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #211
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 275
Target Start/End: Complemental strand, 38186761 - 38186709
Alignment:
| Q |
224 |
ggctaaaatatggttttag-tccctgcaaatatgcctcattttggttttagtc |
275 |
Q |
| |
|
|||||||||||| |||| | |||||||||||||| ||| |||||||||||||| |
|
|
| T |
38186761 |
ggctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtc |
38186709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #212
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 312
Target Start/End: Complemental strand, 40729412 - 40729360
Alignment:
| Q |
260 |
cattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||| |||| ||||||||||| |
|
|
| T |
40729412 |
cattttggttttagtccctgtaaaaatatttttttggttttagtccctgcaaa |
40729360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #213
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 312
Target Start/End: Complemental strand, 42517216 - 42517164
Alignment:
| Q |
260 |
cattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||| |||| ||||||||||| |
|
|
| T |
42517216 |
cattttggttttagtccctgtaaaaatatttttttggttttagtccctgcaaa |
42517164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #214
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 245 - 285
Target Start/End: Complemental strand, 43300899 - 43300859
Alignment:
| Q |
245 |
cctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
43300899 |
cctgcaaatattccttattttagttttagtccctgtaaaaa |
43300859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #215
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 312
Target Start/End: Complemental strand, 44483575 - 44483523
Alignment:
| Q |
260 |
cattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||| |||| ||||||||||| |
|
|
| T |
44483575 |
cattttggttttagtccctgtaaaaatatttttttggttttagtccctgcaaa |
44483523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 83; Significance: 3e-39; HSPs: 170)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 227 - 317
Target Start/End: Complemental strand, 7324189 - 7324099
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatatt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7324189 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatatt |
7324099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 227 - 314
Target Start/End: Complemental strand, 12176640 - 12176553
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12176640 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
12176553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 223 - 314
Target Start/End: Original strand, 34582528 - 34582619
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
34582528 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaacttttgtttttggtccctgcaaaat |
34582619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 19296409 - 19296317
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
19296409 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgtaaaaagaaaattttgttttcggtccctggaaaat |
19296317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 224 - 317
Target Start/End: Complemental strand, 3969009 - 3968916
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatatt |
317 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
3969009 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt |
3968916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 214 - 314
Target Start/End: Complemental strand, 7156170 - 7156070
Alignment:
| Q |
214 |
gttttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
|||||| || ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
7156170 |
gttttaagtaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaa |
7156071 |
T |
|
| Q |
314 |
t |
314 |
Q |
| |
|
| |
|
|
| T |
7156070 |
t |
7156070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 226 - 318
Target Start/End: Complemental strand, 5286949 - 5286858
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaaaatattt |
5286858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 15962391 - 15962300
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| ||||||||||||| |||||||| |
|
|
| T |
15962391 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaa-aaaaaattgtttttggtccgtgcaaaat |
15962300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 215 - 318
Target Start/End: Original strand, 3414378 - 3414481
Alignment:
| Q |
215 |
ttttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||| | ||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| || | ||||||||||||| |||||||| |
|
|
| T |
3414378 |
ttttatctaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgcaaaat |
3414477 |
T |
|
| Q |
315 |
attt |
318 |
Q |
| |
|
|||| |
|
|
| T |
3414478 |
attt |
3414481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 223 - 318
Target Start/End: Original strand, 17771910 - 17772005
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||| |||||||| |||| |||||||||||||| ||||||| |||| |
|
|
| T |
17771910 |
tggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttgtaaaaaaaaaaatttgtttttggtccttgcaaaaaattt |
17772005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 30928681 - 30928769
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
30928681 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
30928769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 8680775 - 8680865
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
8680775 |
ggctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaat |
8680865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 12299140 - 12299046
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||| |||||||||| ||| | |||||| ||||||||||||||||||| |
|
|
| T |
12299140 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaattgttgtttctggtccctgcaaaatattt |
12299046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 12612359 - 12612269
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||| |||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
12612359 |
ggctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtccctgtaaaataaaaattttgtttttggtccttgcaaaat |
12612269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 14655379 - 14655469
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
14655379 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaat |
14655469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 15962027 - 15962117
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||||||| | ||| |||| ||||||||||||||||||||||| |
|
|
| T |
15962027 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgcagaaaaaaaaatttgtttttggtccctgcaaaat |
15962117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 21385584 - 21385490
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| | | |||||||||||||||||||||||||| |
|
|
| T |
21385584 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattt |
21385490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 21993787 - 21993881
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
21993787 |
ggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
21993881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 22543354 - 22543448
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||||||||| |
|
|
| T |
22543354 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaaatattt |
22543448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 22822651 - 22822561
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
22822651 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaat |
22822561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 222 - 314
Target Start/End: Original strand, 494403 - 494493
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |||| ||||||||| |||||||||||| |
|
|
| T |
494403 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaa--ttgtttttgatccctgcaaaat |
494493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 224 - 305
Target Start/End: Complemental strand, 34582892 - 34582811
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtcc |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
34582892 |
ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctgtaaaaaaaaacttttgtttttggtcc |
34582811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 225 - 312
Target Start/End: Original strand, 14428651 - 14428736
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
14428651 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaa--ttgtttttggtccctgcaaa |
14428736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 15076204 - 15076115
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
15076204 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
15076115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 223 - 314
Target Start/End: Complemental strand, 30929045 - 30928956
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |||| |||||||||||||| |||||||| |
|
|
| T |
30929045 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaa--aaaaatttgtttttggtccttgcaaaat |
30928956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 17765009 - 17765104
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||| ||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
17765009 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtttctgtaaaaaaaaaattgttgtttttggtccctgcaaaatattt |
17765104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 225 - 314
Target Start/End: Original strand, 31166871 - 31166959
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
31166871 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaataaaa--ttgtttttggtccctgcaaaat |
31166959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 12419938 - 12419844
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |||| |||| ||||||||| |||||||||||||||| |
|
|
| T |
12419938 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttgatccctgcaaaatattt |
12419844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 225 - 314
Target Start/End: Original strand, 23770162 - 23770249
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |||| ||||||||||||| |||||||| |
|
|
| T |
23770162 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaaa--ttgtttttggtccttgcaaaat |
23770249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 33801743 - 33801656
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||| |||||||||||||||||||| |
|
|
| T |
33801743 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaaa |
33801656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 25431854 - 25431768
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
25431854 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaa----tgtttttggtccctgcaaaat |
25431768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 315
Target Start/End: Complemental strand, 318097 - 318008
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaata |
315 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || |||||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
318097 |
ggctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaaa--ttgtttttggtccctgcaaaata |
318008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 1890452 - 1890363
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
1890452 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
1890363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 2615872 - 2615959
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||||||||||| |||||| ||| |||||||||||||||||||||| |
|
|
| T |
2615872 |
ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctataaaaaaaaa---ttgtttttggtccctgcaaaat |
2615959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 7155797 - 7155886
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
7155797 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
7155886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 8681116 - 8681027
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
8681116 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
8681027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 21995064 - 21995151
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |||| |||||| ||||||||||||| |
|
|
| T |
21995064 |
ggctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctgtaaaaa-aaaaaattgtttatggtccctgcaaa |
21995151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 25136994 - 25137081
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||| |||||||||||||||||||||||| ||| | |||||||||||||||||||| |
|
|
| T |
25136994 |
ggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccctgtaaaaa-aaattgttgtttttggtccctgcaaa |
25137081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 32885673 - 32885762
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||||||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
32885673 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
32885762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 221 - 314
Target Start/End: Original strand, 9896275 - 9896365
Alignment:
| Q |
221 |
gttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||| |||||||| ||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
9896275 |
gttgactaaaatatggttttaatccctgcaaatatgtctcattttagttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
9896365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 227 - 314
Target Start/End: Complemental strand, 19276036 - 19275950
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||| |||||||||||| ||||||| ||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
19276036 |
taaaatatagttttagtccctacaaatatacctcattttggttttagtccctgtaaaaa-aaaaaattgtttttggtccctgcaaaat |
19275950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 224 - 311
Target Start/End: Complemental strand, 31398541 - 31398455
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaa |
311 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||||||||||||||||||| |||||||| |||| || ||||||||||||||||| |
|
|
| T |
31398541 |
ggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtccttgtaaaaa-aaaaattagtttttggtccctgcaa |
31398455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 228 - 314
Target Start/End: Original strand, 543365 - 543450
Alignment:
| Q |
228 |
aaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||| ||||||||||||||| ||||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaa-aaaaatttgtttttggtcccagcaaaat |
543450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 6468310 - 6468399
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||||||||||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
6468310 |
ggctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtccctgtgaaaa-aaaaaattgtttttggtccctgcaaaat |
6468399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 11448537 - 11448626
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
11448537 |
ggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccccgtaaaaa-aaaaaattgtttttggtccctgcaaaat |
11448626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 12419708 - 12419797
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||||| |||| |||||||||| |||||||||||| |
|
|
| T |
12419708 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcctggtaaaaa-aaaaatttgtttttgttccctgcaaaat |
12419797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 13150750 - 13150660
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||| ||| |||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
13150750 |
ggctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtccctgtaaacagaaatatttgtttttggtccctgcaaaat |
13150660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 20467718 - 20467624
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||| |||| ||||| || | ||||||||| |||||||||||||||| |
|
|
| T |
20467718 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgcaaaaaaaatttgttgtttttgatccctgcaaaatattt |
20467624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 33808620 - 33808710
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||| |||||||||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
33808620 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaat |
33808710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 227 - 314
Target Start/End: Original strand, 10091039 - 10091123
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
10091123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 227 - 312
Target Start/End: Complemental strand, 26376042 - 26375957
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| ||||| | ||| ||||||||||||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtagaaaaaaaataatatttgtggtccctgcaaa |
26375957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 227 - 312
Target Start/End: Complemental strand, 34990312 - 34990228
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |||| ||||||||||||||| |||| |
|
|
| T |
34990312 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaa-aaaaaattgtttttggtccctacaaa |
34990228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 3414752 - 3414664
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| ||| |||||||||||||||||| ||||| ||| | |||||||||||||||||||| |
|
|
| T |
3414752 |
ggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaa |
3414664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 6412579 - 6412491
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
6412579 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
6412491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 10910964 - 10910876
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||||| || | |||||||||||||||||||| |
|
|
| T |
10910964 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaataaatttgttgtttttggtccctgcaaa |
10910876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 227 - 314
Target Start/End: Original strand, 1890062 - 1890149
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||| |||||||||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
1890062 |
taaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaat |
1890149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 222 - 313
Target Start/End: Original strand, 12611993 - 12612084
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||| |||||||| || |||||| ||||||||||||||||||||||||||| |
|
|
| T |
12611993 |
ttggctaaaatatggtgttagtccctgcaaatatgccctgttttagttttagttcccgtaaaataaaaattttgtttttggtccctgcaaaa |
12612084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 26375693 - 26375781
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||| |||||||||||| |||| ||||||||| |||||||||||| |
|
|
| T |
26375693 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttaatccctgtaaaaaaaaaa--ttgtttttgttccctgcaaaat |
26375781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 225 - 314
Target Start/End: Complemental strand, 494751 - 494664
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||| ||| |||||||| |||| |||||||| ||||||||||||| |
|
|
| T |
494751 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccttgtaaaaaaaaaa--ttgtttttagtccctgcaaaat |
494664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 227 - 314
Target Start/End: Complemental strand, 3356495 - 3356412
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| || |||||||||||||||| ||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctataaaaaaaa----ttgtttttggtccctggaaaat |
3356412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 217 - 311
Target Start/End: Original strand, 10910622 - 10910716
Alignment:
| Q |
217 |
ttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaa |
311 |
Q |
| |
|
||||| |||||||||||||||||| ||| || |||||||| ||| |||||||||||||||||||||||| || | ||||||||||||||||||| |
|
|
| T |
10910622 |
ttatgatggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaa |
10910716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 18024375 - 18024281
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || |||||||||||||||||||||||| || | |||||||| |||| |||||||||||| |
|
|
| T |
18024375 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgtaaaaaaaatttgttgttttttgtccttgcaaaatattt |
18024281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 222 - 312
Target Start/End: Original strand, 24901237 - 24901326
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||| | |||||||| ||| | |||||||||||||||||||| |
|
|
| T |
24901237 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt-cttgtaaaaaaaaattgttgtttttggtccctgcaaa |
24901326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 224 - 285
Target Start/End: Complemental strand, 1007509 - 1007448
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1007509 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaa |
1007448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 224 - 293
Target Start/End: Complemental strand, 24274131 - 24274062
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattt |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| ||||||| |
|
|
| T |
24274131 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaattt |
24274062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 777677 - 777764
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| |||| |||||||||||||||||| |||| |||| ||||||||||||||||||||| |
|
|
| T |
777677 |
ggctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtccctggtaaaa-aaaaatttgtttttggtccctgcaaa |
777764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 2373179 - 2373267
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| || |||| |||||||| ||||||||||| |
|
|
| T |
2373179 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtccctgtagtaaaaaaaaattgtttttagtccctgcaaa |
2373267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 313
Target Start/End: Original strand, 3356142 - 3356227
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||| |||||||| ||| | |||||||||||||||||| |
|
|
| T |
3356142 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccttgtaaaaaaaaa----tatttttggtccctgcaaaa |
3356227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 13268109 - 13268197
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||| ||||||||||||| |||||| || | ||||||||||||||||||| |
|
|
| T |
13268109 |
ggctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagtccctataaaaataatttgatgtttttggtccctgcaaa |
13268197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 22543718 - 22543630
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| ||||| | | |||||||||||||||||||| |
|
|
| T |
22543718 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
22543630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 296
Target Start/End: Complemental strand, 22792899 - 22792827
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgt |
296 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||||||||||||||| ||||||| | |||||||| |
|
|
| T |
22792899 |
ggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccccgtaaaaaaataattttgt |
22792827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 24692979 - 24692892
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||| ||||| ||| |||||||||||| ||||||||| |
|
|
| T |
24692979 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctgcaaaaaaaaa---ttgtttttggtctctgcaaaat |
24692892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 223 - 314
Target Start/End: Original strand, 30239292 - 30239381
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||| ||| ||||||||||||||||| ||||| || | ||||||||||||||||||||||| |
|
|
| T |
30239292 |
tggctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagtccctataaaa--aacaatttgtttttggtccctgcaaaat |
30239381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 292
Target Start/End: Complemental strand, 33131850 - 33131782
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt |
292 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
33131850 |
ggctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaatt |
33131782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 317812 - 317896
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||| |||||||||||| ||||||||||| || |||||||||||||||||||| |
|
|
| T |
317812 |
ggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagcccctgtaaaaaaaa----ttgtttttggtccctgcaaa |
317896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 224 - 299
Target Start/End: Complemental strand, 11449169 - 11449094
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttt |
299 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||| ||||||||||||||| |||| ||||||| |
|
|
| T |
11449169 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctgtaaaaaaaaaaaattgtttt |
11449094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 15116673 - 15116761
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||| ||||||||||||| || ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
15116673 |
ggctaaaatatggttttagtcgctgcaaatat--ctcgttttggttttagttccggtaaaaaaaaaaaattgtttttggtccctgcaaaat |
15116761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 223 - 318
Target Start/End: Original strand, 19267564 - 19267659
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||| || ||||||||||||||||||| |||| || | |||||||||||| |||||||||||| |
|
|
| T |
19267564 |
tggctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtccctgtgaaaaaaatttgctgtttttggtccttgcaaaatattt |
19267659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 222 - 285
Target Start/End: Complemental strand, 21995427 - 21995364
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
21995427 |
ttggctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccctgtaaaaa |
21995364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 219 - 310
Target Start/End: Complemental strand, 24901559 - 24901469
Alignment:
| Q |
219 |
atgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgca |
310 |
Q |
| |
|
|||| |||||||||||| |||| |||||| |||||||| || ||||||||||||||||||||||||| ||| | |||||||||||||||||| |
|
|
| T |
24901559 |
atgtaggctaaaatatgattttggtccctacaaatatgacttattttggttttagtccctgtaaaaa-aaattgttgtttttggtccctgca |
24901469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 543724 - 543634
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| | ||||||||||| |||||| |||| || | ||||||||||||||||||||||| |
|
|
| T |
543724 |
ggctaaaatatgattttagtccctgcaaatatgctttgttttggttttaatccctggtaaaaaaataatttgtttttggtccctgcaaaat |
543634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 2616240 - 2616146
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcc------tcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
2616240 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttggttttagtccctgtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
2616146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 6412218 - 6412312
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |||| | |||||||||||||||||||||||||| |
|
|
| T |
6412218 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttgttgtttttggtccctgcaaaatattt |
6412312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 25137357 - 25137299
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25137357 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
25137299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 222 - 307
Target Start/End: Complemental strand, 31167202 - 31167119
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccct |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||| ||| |||| |||||||||||||||| |
|
|
| T |
31167202 |
ttggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccctggtaaa--aaaaatttgtttttggtccct |
31167119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 223 - 312
Target Start/End: Complemental strand, 31186592 - 31186502
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgttt-ttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||| |||| ||||||||||||||||||| ||| | |||||| ||||||| |||||| |
|
|
| T |
31186592 |
tggctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgttttagtccctgtaaaaaaaaattgttgtttattggtccatgcaaa |
31186502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 15117040 - 15116955
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| ||||||||| |||||||| || |||||||||||||||||||||| |
|
|
| T |
15117040 |
ggctaaaatatggttttagtccctgcaaatatgcctc-ctttgattttagtccatgtaaaaaaaa----ttgtttttggtccctgcaaaat |
15116955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 19296108 - 19296194
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| || ||||| |||||||||||||||||| ||| |||||||||||| |||||||| |
|
|
| T |
19296108 |
ggctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtccctgtaaaaaaaaa----tgtttttggtccttgcaaaat |
19296194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 224 - 285
Target Start/End: Original strand, 21147404 - 21147465
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
21147404 |
ggctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtccctgtaaaaa |
21147465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 22822307 - 22822396
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt-ccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||| ||||||||||||| ||||| |||| ||| |||||| ||||||||||||||| |
|
|
| T |
22822307 |
ggctaaaatatggttttagtctctgcaaatatacctcgttttggttttagtaccctggtaaaaaaaatttttgtatttggtccctgcaaa |
22822396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 226 - 314
Target Start/End: Complemental strand, 6591440 - 6591352
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||| ||||||||||||| ||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtttctggtaaaaaaaaaaattgtttttggtccctgcaaaat |
6591352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 8170151 - 8170064
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||| |||||||| ||| | ||||||||||||||| |||| |
|
|
| T |
8170151 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcattgtaaaaa-aaattgttgtttttggtccctacaaa |
8170064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 222 - 318
Target Start/End: Complemental strand, 11129545 - 11129450
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||| |||||||||| || | |||||||| |||| |||||||||||||||| |||| |||| |
|
|
| T |
11129545 |
ttggctaaaatatgattttactccctgcaaatatgcctcgttttggttttcgttcttgtaaaaa-aaaaaattgtttttggtccctgtaaaaaattt |
11129450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 21385251 - 21385339
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
21385251 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaatttttgttgtttttggtccctgcaaa |
21385339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 225 - 314
Target Start/End: Original strand, 34989962 - 34990046
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||| ||||||| |||||||||| || |||||||||||||||||||||| |
|
|
| T |
34989962 |
gctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagt-cctgtaaaaaaaa----ttgtttttggtccctgcaaaat |
34990046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 778042 - 777951
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||| |||||||| || ||||||| |||| ||||||||||||||| |||||| |
|
|
| T |
778042 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagtttctggtaaaaaaaaaaaattgtttttggtccctacaaaat |
777951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 224 - 283
Target Start/End: Original strand, 1007124 - 1007183
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
1007124 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaaa |
1007183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 224 - 279
Target Start/End: Complemental strand, 21994403 - 21994348
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21994403 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
21994348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 19690393 - 19690451
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
19690393 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
19690451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 23502540 - 23502482
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
23502540 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctgtaa |
23502482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 25121184 - 25121277
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||| |||||||||||||| || |||||| ||| | ||||||||| |||||||||||||||| |
|
|
| T |
25121184 |
ggctaaaatatggttttcatcc-tgcaaatatgtctcgttttggttttagtctctttaaaaaaaaattgttgtttttgatccctgcaaaatattt |
25121277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 224 - 311
Target Start/End: Complemental strand, 9896637 - 9896553
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaa |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||| ||| || |||| |||||||||| ||||||||| |
|
|
| T |
9896637 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccttgtgaa---aaaaatttgtttttgctccctgcaa |
9896553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 223 - 314
Target Start/End: Original strand, 12176384 - 12176472
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||| || || ||||||| ||| |||| |||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
12176384 |
tggctaaaatatggttttagcccatgtaaatatgtctcgttttagttttagtccatgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
12176472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 226 - 283
Target Start/End: Original strand, 13617531 - 13617588
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgtaaa |
13617588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 226 - 290
Target Start/End: Complemental strand, 14428948 - 14428884
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaa |
290 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| || ||||||||||||||| |||||||| |||| |
|
|
| T |
14428948 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccttgtaaaaaaaaaa |
14428884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 226 - 282
Target Start/End: Original strand, 19320769 - 19320825
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
19320769 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttaatccctgtaa |
19320825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 224 - 284
Target Start/End: Original strand, 31198615 - 31198675
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |||| |
|
|
| T |
31198615 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgcaaaa |
31198675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 224 - 283
Target Start/End: Complemental strand, 3276354 - 3276295
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||| |||||| |
|
|
| T |
3276354 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaaa |
3276295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 224 - 279
Target Start/End: Original strand, 3968645 - 3968700
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
3968645 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3968700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 227 - 306
Target Start/End: Original strand, 20467354 - 20467433
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccc |
306 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||| |||||||||||||||||| ||||| || | ||||||||| |||| |
|
|
| T |
20467354 |
taaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttgatccc |
20467433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 224 - 279
Target Start/End: Original strand, 24273828 - 24273883
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||| |||| |
|
|
| T |
24273828 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagttcctg |
24273883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 12757610 - 12757668
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||| |||||| |
|
|
| T |
12757610 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcactgtaa |
12757668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 14656260 - 14656202
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
14656260 |
ggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgtaa |
14656202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 222 - 284
Target Start/End: Original strand, 18024009 - 18024071
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
|||| |||||||||||||| ||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18024009 |
ttggataaaatatggttttggtctttgcaaatatgcctcgttttggttttagtccctgtaaaa |
18024071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 274
Target Start/End: Complemental strand, 19321131 - 19321081
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
274 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
19321131 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
19321081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 225 - 283
Target Start/End: Complemental strand, 30479421 - 30479363
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||||||||||| || | |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30479421 |
gctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctgtaaa |
30479363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 6591115 - 6591210
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttgg------ttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||| |||| |||| ||||||||||||||||| ||||| |
|
|
| T |
6591115 |
ggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttgattttagtccctggtaaaa-aaaaatttgtttttggtccctgtaaaat |
6591210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 49 - 130
Target Start/End: Original strand, 10300904 - 10300985
Alignment:
| Q |
49 |
cttgaacaaagcatttttcaactccaaagaaccccatctattaaagctctttttactaatagcttcatcatttgcaagccac |
130 |
Q |
| |
|
||||||||| |||||||| || ||||||| |||| |||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
10300904 |
cttgaacaaggcattttttaatgccaaagaccccctactattaaagctctttttaatgttagcttcatcatttgcaagccac |
10300985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 224 - 304
Target Start/End: Original strand, 14655903 - 14655983
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtc |
304 |
Q |
| |
|
|||||||| |||||||| |||||||||||||| || ||||||||||||||||||||||| ||| | |||||||||||| |
|
|
| T |
14655903 |
ggctaaaacatggttttggtccctgcaaatatatttcgttttggttttagtccctgtaaaataaaattgttgtttttggtc |
14655983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 19129520 - 19129432
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| | | ||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
19129520 |
ggctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtccctgtaattttatttttttgtttttggtccctgcaaa |
19129432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 25431576 - 25431663
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| ||||| |||||| ||||||| || ||||| ||||||| |||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
25431576 |
ggctaaaatatgattttaatccctgtaaatatgtttcgttttgattttagttcctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
25431663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 236 - 283
Target Start/End: Complemental strand, 13617804 - 13617757
Alignment:
| Q |
236 |
gttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13617804 |
gttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaa |
13617757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 224 - 279
Target Start/End: Original strand, 19129336 - 19129391
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||| ||||||| ||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19129336 |
ggctacaatatggctttggtccctgcaaatatgcctcgttttggttttagtccctg |
19129391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 224 - 271
Target Start/End: Original strand, 23502237 - 23502284
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggtttt |
271 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
23502237 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
23502284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 1214696 - 1214750
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct |
278 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
1214696 |
ggctaaaatattgttttggtccctgcaaatatgtcgcattttggttttagtccct |
1214750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 19267912 - 19267854
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| || |||| ||||||| | ||||||||||||||||||||||| |
|
|
| T |
19267912 |
ggctaaaatatggttttggttcctgtaaatatgtcccattttggttttagtccctgtaa |
19267854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 25121496 - 25121438
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| || |||||||||||| || ||||||||||||||||||||| |
|
|
| T |
25121496 |
ggctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtccctgtaa |
25121438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 225 - 318
Target Start/End: Original strand, 23628799 - 23628891
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||| |||||||||||||| || |||||||||||||| ||||||||| | ||| || ||||||| ||||||||||||| |
|
|
| T |
23628799 |
gctaaaatatggttttggtccctgcaaatatatttcgttttggttttagtcactgtaaaaa-agaataatgattttggtatctgcaaaatattt |
23628891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 265
Target Start/End: Complemental strand, 23770439 - 23770398
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcatttt |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
23770439 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 246 - 318
Target Start/End: Original strand, 3276048 - 3276119
Alignment:
| Q |
246 |
ctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||| ||| ||||| ||||| ||| |||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
3276048 |
ctgcaaatatgtctcgttttgattttaatccttgtaaaaa-aaattgttgtttttggtccctgcaaaatattt |
3276119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 244 - 314
Target Start/End: Original strand, 5286606 - 5286675
Alignment:
| Q |
244 |
ccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||| | ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
5286606 |
ccctgcaaatatgcctcgttttgattttagtccttggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
5286675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 11926033 - 11925946
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||| ||| ||||||| | | ||||||||||||| | |||||||| ||| | ||||||||||||||| |||| |
|
|
| T |
11926033 |
ggctaaaatatggttttggtctctgaaaatatgtcgcgttttggttttagttcttgtaaaaa-aaattgttgtttttggtcccttcaaa |
11925946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 222 - 278
Target Start/End: Original strand, 12298820 - 12298876
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct |
278 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| ||| |||| |||||||||||| |
|
|
| T |
12298820 |
ttggttaaaatatggttttggtccctgcaaatatgtctcgttttcgttttagtccct |
12298876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 12757936 - 12757849
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||| ||| |||| ||||||||||||||| || ||||||||||| ||| |||||||| ||| | ||||||||||||| |||||| |
|
|
| T |
12757936 |
ggctaaaacatgattttggtccctgcaaatatgtatccttttggttttaatccttgtaaaaa-aaattgttgtttttggtccttgcaaa |
12757849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 223 - 283
Target Start/End: Original strand, 15442936 - 15442996
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||| ||||| ||||||| ||| |||| |
|
|
| T |
15442936 |
tggctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtgcctctaaa |
15442996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #136
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 240 - 312
Target Start/End: Complemental strand, 17238403 - 17238331
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| || ||||| |||| ||||||||||| |
|
|
| T |
17238403 |
tagtccctgcaaatatctgacattttggttttagtccctgtaaaaataattttttggttttagtccctgcaaa |
17238331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #137
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 225 - 269
Target Start/End: Original strand, 27764914 - 27764958
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggtt |
269 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
27764914 |
gctaaaatatggttttagtccctacaaatatgtctcattttggtt |
27764958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #138
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 227 - 279
Target Start/End: Original strand, 31276105 - 31276157
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||| |||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
31276105 |
taaactatggttttggtccctacaaatatgcctcattttggttttggtccctg |
31276157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #139
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 224 - 283
Target Start/End: Complemental strand, 1214996 - 1214937
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||| || ||||||||||| ||| ||||||||||||||||| |||| |
|
|
| T |
1214996 |
ggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccctataaa |
1214937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #140
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 224 - 283
Target Start/End: Complemental strand, 17765375 - 17765316
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||| |||||||||||||||| |
|
|
| T |
17765375 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtccctgtaaa |
17765316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #141
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 242 - 313
Target Start/End: Original strand, 29846807 - 29846877
Alignment:
| Q |
242 |
gtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
||||||||||||||| |||||| ||||| ||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
29846807 |
gtccctgcaaatatgggtcatttaagttttcgtccctgtaaaaa-aaaaaattgtttttggtccctgcaaaa |
29846877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #142
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 230 - 269
Target Start/End: Complemental strand, 32885960 - 32885921
Alignment:
| Q |
230 |
aatatggttttagtccctgcaaatatgcctcattttggtt |
269 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32885960 |
aatatggttttagtccctgcaaatatgtctcattttggtt |
32885921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #143
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 1007197 - 1007239
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1007197 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
1007239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #144
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 1875502 - 1875560
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||| | |||| |||||||||||||||||| |||||| ||| |||||||||| |
|
|
| T |
1875502 |
ggctaaaatatagctttaatccctgcaaatatgcctcgttttgggtttggtccctgtaa |
1875560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #145
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 265 - 314
Target Start/End: Complemental strand, 2373454 - 2373404
Alignment:
| Q |
265 |
tggttttagtccctgtaaaaagaaaat-tttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
2373454 |
tggttttagtccctgtaaaaaaaaaaaatttgtttttggtccctgcaaaat |
2373404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #146
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 6564943 - 6564886
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||| |||||||||||||| |||||| |
|
|
| T |
6564943 |
ggctaaaat-tggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaa |
6564886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #147
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 7323864 - 7323955
Alignment:
| Q |
224 |
ggctaaaatatggttttagt----ccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| | || |||||||||| ||| ||||||||||||||||||||||| |||||| | ||||||| ||||||||||| |
|
|
| T |
7323864 |
ggctaaaatatggttttaattagcccttgcaaatatgtctcgttttggttttagtccctgtaaaa--aaaattgt-tttttgggccctgcaaaat |
7323955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #148
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 15722610 - 15722668
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
15722610 |
ggctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtccctgtaa |
15722668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #149
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 24901311 - 24901353
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24901311 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
24901353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #150
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 25137066 - 25137108
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25137066 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
25137108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #151
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 31198688 - 31198730
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31198688 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
31198730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #152
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 222 - 283
Target Start/End: Original strand, 11925737 - 11925798
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||| ||||| |||| ||||||||||||||| ||| ||||| |||||||| ||||||| |
|
|
| T |
11925737 |
ttggctaatatatgattttggtccctgcaaatatgtctcgttttgattttagtctctgtaaa |
11925798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #153
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 237 - 278
Target Start/End: Complemental strand, 17765302 - 17765261
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccct |
278 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17765302 |
ttttggtccctgcaaatatgcctcattttggttttggtccct |
17765261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #154
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 225 - 282
Target Start/End: Complemental strand, 31276339 - 31276282
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||| ||||| ||||||||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
31276339 |
gctaaaataaagttttggtccctgcaaatatgtctcgttttgattttagtccctgtaa |
31276282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #155
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 240 - 312
Target Start/End: Complemental strand, 3485143 - 3485071
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||| | ||||| |||| ||||||||||| |
|
|
| T |
3485143 |
tagtccctgcaaatatgtgacattttggttttagtccctgcaaaaatatttttttgattttagtccctgcaaa |
3485071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #156
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 222 - 282
Target Start/End: Complemental strand, 19690761 - 19690702
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||| ||| |||| |||||||||| ||||| |
|
|
| T |
19690761 |
ttggcgaaaatatggttttggtccctgcaaatatgtctcgtttt-gttttagtccgtgtaa |
19690702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #157
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 6564581 - 6564636
Alignment:
| Q |
224 |
ggctaaaatatggttttag-tccctgcaaatatgcctcattttggttttagtccct |
278 |
Q |
| |
|
||||||| ||||||||| | |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
6564581 |
ggctaaattatggtttttggtccctgcaaatatgtctcgttttggttttagtccct |
6564636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #158
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 3968718 - 3968760
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
3968718 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
3968760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #159
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 6412506 - 6412464
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
6412506 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
6412464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #160
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 265 - 314
Target Start/End: Complemental strand, 6468633 - 6468583
Alignment:
| Q |
265 |
tggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
6468633 |
tggttttagtccctgtaaaaaaaaaaaaattgtttttggtccctgcaaaat |
6468583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #161
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 271
Target Start/End: Original strand, 13617602 - 13617636
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggtttt |
271 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
13617602 |
ttttggtccctgcaaatatgcctcattttggtttt |
13617636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #162
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 19267841 - 19267799
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
19267841 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
19267799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #163
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 19320840 - 19320882
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
19320840 |
ttttggtccttgcaaatatgcctcattttggttttggtccctg |
19320882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #164
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 21385324 - 21385366
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
21385324 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
21385366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #165
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 22543645 - 22543603
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
22543645 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
22543603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #166
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 242 - 318
Target Start/End: Complemental strand, 33747008 - 33746935
Alignment:
| Q |
242 |
gtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||| | | ||| ||||| |||| |||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
33747008 |
gtccctgcaaatatggcccgtttaagttttcgtccttgtaaaaaaaaa---ttgtttttggtccctgcaaaatattt |
33746935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #167
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 286
Target Start/End: Complemental strand, 19129447 - 19129398
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaag |
286 |
Q |
| |
|
|||| ||||||||||||||| ||| |||||||||| ||||||| |||||| |
|
|
| T |
19129447 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctgcaaaaag |
19129398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #168
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 222 - 255
Target Start/End: Complemental strand, 20897558 - 20897525
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatat |
255 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
20897558 |
ttggctaaaatatggttttggtccctgcaaatat |
20897525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #169
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 312
Target Start/End: Complemental strand, 8926538 - 8926486
Alignment:
| Q |
260 |
cattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||| |||| ||||||||||| |
|
|
| T |
8926538 |
cattttggttttagtccctgtaaaaatatttttttggttttagtccctgcaaa |
8926486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #170
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 260 - 312
Target Start/End: Complemental strand, 8936795 - 8936743
Alignment:
| Q |
260 |
cattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||| |||| ||||||||||| |
|
|
| T |
8936795 |
cattttggttttagtccctgtaaaaatatttttttggttttagtccctgcaaa |
8936743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 83; Significance: 3e-39; HSPs: 263)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 52017870 - 52017780
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52017870 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttgtttttagtccctgcaaaat |
52017780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 224 - 313
Target Start/End: Original strand, 52017505 - 52017594
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
52017505 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaagaaaattttgtttttggttcctccaaaa |
52017594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 224 - 313
Target Start/End: Original strand, 55072389 - 55072478
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
55072389 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaagaaaattttgtttttggtcccttcaaaa |
55072478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 223 - 314
Target Start/End: Original strand, 22099542 - 22099633
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
22099542 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaattttgtttttggtccatgcaaaat |
22099633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 223 - 318
Target Start/End: Complemental strand, 31560696 - 31560601
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
31560696 |
tggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
31560601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 35415635 - 35415543
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| ||| |||||||||||||||||||||||| |
|
|
| T |
35415635 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaatttttgtttttggtccctgcaaaat |
35415543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 227 - 314
Target Start/End: Original strand, 41619902 - 41619989
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
41619902 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaattttgtttttggtccctgcaaaat |
41619989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 215 - 318
Target Start/End: Original strand, 46115405 - 46115508
Alignment:
| Q |
215 |
ttttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| || | ||||||||||||| |||||||| |
|
|
| T |
46115405 |
ttttatattggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgcaaaat |
46115504 |
T |
|
| Q |
315 |
attt |
318 |
Q |
| |
|
|||| |
|
|
| T |
46115505 |
attt |
46115508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 215 - 318
Target Start/End: Original strand, 46128539 - 46128642
Alignment:
| Q |
215 |
ttttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| || | ||||||||||||| |||||||| |
|
|
| T |
46128539 |
ttttatattggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgcaaaat |
46128638 |
T |
|
| Q |
315 |
attt |
318 |
Q |
| |
|
|||| |
|
|
| T |
46128639 |
attt |
46128642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 46292651 - 46292556
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| || | |||||||||||||||||||||||| |
|
|
| T |
46292651 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtctctgtaaaaaaaaatttgtagtttttggtccctgcaaaatattt |
46292556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 223 - 314
Target Start/End: Complemental strand, 53717175 - 53717084
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |||| |||||||||| |||||||||||| |
|
|
| T |
53717175 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaacaaaaaaaatttgtttttgatccctgcaaaat |
53717084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 13530713 - 13530619
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
13530713 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattt |
13530619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 13631228 - 13631322
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
13631228 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
13631322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 14487802 - 14487896
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||| ||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
14487802 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
14487896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 35464018 - 35464112
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
35464018 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
35464112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 43231389 - 43231295
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
43231389 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattt |
43231295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 50822294 - 50822200
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| ||||| ||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
50822294 |
ggctaaaatatggttttactccatgcaaatatgtctcatgttgattttagtccctgtaaaaagaaaattttgtttttgatccctgcaaaatattt |
50822200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 225 - 314
Target Start/End: Complemental strand, 36702362 - 36702273
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||| |||||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
36702362 |
gctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtccctgtaaagagaaaaatttgtttttggtccctgcaaaat |
36702273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 123534 - 123622
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
123534 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaa |
123622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 227 - 314
Target Start/End: Original strand, 38054549 - 38054634
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
38054549 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
38054634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 222 - 312
Target Start/End: Original strand, 50714238 - 50714327
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |||||||||||||||||||| |
|
|
| T |
50714238 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaaa |
50714327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 223 - 318
Target Start/End: Complemental strand, 4279336 - 4279241
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| ||||||||||||||| ||||| ||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
4279336 |
tggctaaaatatgattttagtccctgcaaatatggctcgttttggttttagtccttgtaataaggaaattttgtttttggtcccagcaaaatattt |
4279241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 18205156 - 18205244
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |||| |||||||||||||||||||||| |
|
|
| T |
18205156 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctataaaaaaaaaa--ttgtttttggtccctgcaaaat |
18205244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 227 - 313
Target Start/End: Complemental strand, 51545966 - 51545882
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
51545966 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaa--ttgtttttggtccctgcaaaa |
51545882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 2180220 - 2180309
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||| |||||||| |
|
|
| T |
2180220 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa-aaaaaattggttttggtccttgcaaaat |
2180309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 6827874 - 6827784
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
6827874 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaat |
6827784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 22099912 - 22099822
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||||||| |||| |||||||||||||| |||||||| |
|
|
| T |
22099912 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgtaaaaaaaaaaatttgtttttggtccttgcaaaat |
22099822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 24774045 - 24774139
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| || | ||||||||||||| |||||||||||| |
|
|
| T |
24774045 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttattgtttttggtccttgcaaaatattt |
24774139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 25423924 - 25424018
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
25423924 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatattt |
25424018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 29463913 - 29463824
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
29463913 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttggtccctgtaaaaa-aaaaaattgtttttggtccctgcaaaat |
29463824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 41345853 - 41345943
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
41345853 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaat |
41345943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 51762870 - 51762964
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||| || ||| |||||||||||| ||||||||||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
51762870 |
ggctaaaatatggtattggtctctgcaaatatgcttcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
51762964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 13479611 - 13479525
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
13479611 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaa--aaaaatttgtttttggtccctgcaaa |
13479525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 223 - 312
Target Start/End: Complemental strand, 42848392 - 42848303
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| ||| | |||||||||||||||||||| |
|
|
| T |
42848392 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaa |
42848303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 14488187 - 14488099
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| || | |||||||||||||||||||| |
|
|
| T |
14488187 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
14488099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 16712691 - 16712604
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||| ||||||||| |
|
|
| T |
16712691 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtctctgcaaaat |
16712604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 19321861 - 19321769
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || |||||||||||||||||||||||| ||| | |||||||||||||||||||||| |
|
|
| T |
19321861 |
ttggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaat |
19321769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 51709027 - 51708938
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
51709027 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtctctggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
51708938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 51545629 - 51545717
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |||||||||||||| ||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
51545629 |
ggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtctctgtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
51545717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 223 - 318
Target Start/End: Complemental strand, 53308069 - 53307975
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| | | |||||||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
53308069 |
tggctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctgtaaaaa-aaattgttgtttttggtccctgcaaaatattt |
53307975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 6827546 - 6827636
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||| ||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
6827546 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcgctggtaaaaaaaaaatttgtttttggtccctgcaaaat |
6827636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 9289266 - 9289356
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
9289266 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaat |
9289356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 226 - 314
Target Start/End: Original strand, 9445951 - 9446036
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
9445951 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
9446036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 222 - 312
Target Start/End: Original strand, 23245229 - 23245319
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
23245229 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
23245319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 23245595 - 23245501
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||||||||||||| ||| | |||||||||||||| ||||||||||| |
|
|
| T |
23245595 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatattt |
23245501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 29499182 - 29499276
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| | | |||||||||||||||||||||||||| |
|
|
| T |
29499182 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattt |
29499276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 30046792 - 30046698
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| | | |||||||||||||||||||||||||| |
|
|
| T |
30046792 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattt |
30046698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 30061133 - 30061039
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| | | |||||||||||||||||||||||||| |
|
|
| T |
30061133 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattt |
30061039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 32365094 - 32365183
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
32365094 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtgaaaa-aaaaaattgtttttggtccctgcaaaat |
32365183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 313
Target Start/End: Complemental strand, 32365483 - 32365396
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |||| |||| ||||||||||||||||||||| |
|
|
| T |
32365483 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgtgaaaaaaaaa--ttgtttttggtccctgcaaaa |
32365396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 222 - 312
Target Start/End: Complemental strand, 35464384 - 35464294
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
35464384 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
35464294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 42848027 - 42848121
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||| |||||||||||||||||||||||| ||| | |||||||||||||| ||||||||||| |
|
|
| T |
42848027 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccccgcaaaatattt |
42848121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 240 - 318
Target Start/End: Original strand, 54208477 - 54208555
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||| | |||||||||||| ||||||||||||| |
|
|
| T |
54208477 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtctctgcaaaatattt |
54208555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 227 - 297
Target Start/End: Complemental strand, 55072709 - 55072639
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtt |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
55072709 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgtaaaaagaaaattttgtt |
55072639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 223 - 314
Target Start/End: Complemental strand, 50714566 - 50714476
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
50714566 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
50714476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 5882552 - 5882638
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
5882552 |
ggctaaaatatggttttagtcc-tgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
5882638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 9289639 - 9289546
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
9289639 |
ggcttaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaaaatattt |
9289546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 13064159 - 13064246
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| ||| |||||||||||||| ||||||| |
|
|
| T |
13064159 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaa---ttgtttttggtccccgcaaaat |
13064246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 25424312 - 25424224
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| || | |||||||||||||||||||| |
|
|
| T |
25424312 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
25424224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 43231088 - 43231176
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| ||||| ||| | |||||||||||||||||||| |
|
|
| T |
43231088 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaa |
43231176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 52442092 - 52442005
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||| |||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
52442092 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
52442005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 5052584 - 5052496
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |||| |||||||| ||||||||||||| |
|
|
| T |
5052584 |
ggctacaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaa--ttgtttttagtccctgcaaaat |
5052496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 34361803 - 34361891
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |||||||| |||| ||||||||| |||||||||||| |
|
|
| T |
34361803 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaaaaaaaaaa--ttgtttttgatccctgcaaaat |
34361891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 226 - 312
Target Start/End: Original strand, 43368467 - 43368551
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
43368467 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaaaaaaaaaa--ttgtttttggtccctgcaaa |
43368551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 45593586 - 45593498
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||| ||||||||||||| |||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
45593586 |
ggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcctgtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
45593498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 224 - 313
Target Start/End: Complemental strand, 52430100 - 52430014
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||| ||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
52430100 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaa |
52430014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 222 - 312
Target Start/End: Complemental strand, 26412586 - 26412496
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
26412586 |
ttggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
26412496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 229 - 314
Target Start/End: Complemental strand, 27008401 - 27008318
Alignment:
| Q |
229 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |||| ||||||||||||| |||||||| |
|
|
| T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaa--ttgtttttggtccttgcaaaat |
27008318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 35415299 - 35415389
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| || |||||||||||||||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
35415299 |
ggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaat |
35415389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 41620256 - 41620166
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| || |||||||||||||||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
41620256 |
ggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaat |
41620166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 51738137 - 51738231
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| ||| ||||||||||| |||||||||||| ||| | || ||||||||||||||||||||||| |
|
|
| T |
51738137 |
ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttactccctgtaaaaaaaaattgttctttttggtccctgcaaaatattt |
51738231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 229 - 314
Target Start/End: Complemental strand, 123893 - 123805
Alignment:
| Q |
229 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtccc--tgtaaaaagaaaattttg-tttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |||| ||||||||||||||||||| |
|
|
| T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtcccctggtaaaaaaaaaaatttgttttttggtccctgcaaaat |
123805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 225 - 314
Target Start/End: Original strand, 11285504 - 11285592
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |||| ||||||||||| |||| ||||| |
|
|
| T |
11285504 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaa-aaaaaattgtttttggttcctgtaaaat |
11285592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 224 - 285
Target Start/End: Complemental strand, 13064465 - 13064404
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
13064465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaa |
13064404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 226 - 314
Target Start/End: Complemental strand, 18831176 - 18831090
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||| ||||||| || |||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
18831176 |
ctaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtccctgtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
18831090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 32208542 - 32208630
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| ||| ||||||||||||||| |||||| |
|
|
| T |
32208542 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctagtaaaaaaaaa---ttgtttttggtccctacaaaat |
32208630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 224 - 301
Target Start/End: Complemental strand, 36054150 - 36054073
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttg |
301 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| ||| | ||||||||| |
|
|
| T |
36054150 |
ggctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaattattgtttttg |
36054073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 52441763 - 52441849
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
52441763 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaaaaaaa----ttgtttttggtccctgcaaaat |
52441849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 8760604 - 8760691
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||| |||||| |||||||||||||| ||| |||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
8760604 |
ggctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
8760691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 226 - 318
Target Start/End: Complemental strand, 19903653 - 19903561
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| ||||||||||||||| |||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccatgtaaaaaaattttgttgtttttggtccctgcaaaatattt |
19903561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 23778964 - 23779053
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| | | ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
23778964 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcttggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
23779053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 223 - 314
Target Start/End: Original strand, 27008083 - 27008172
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
27008083 |
tggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgttaaaaaaaaa--aagtttttggtccctgcaaaat |
27008172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 222 - 313
Target Start/End: Original strand, 28809009 - 28809098
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| || |||||||||||||||||||||||| |||| ||||||||| ||||||||||| |
|
|
| T |
28809009 |
ttggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccctgtaaaaaaaaaa--ttgtttttgatccctgcaaaa |
28809098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 46115779 - 46115691
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
46115779 |
ggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
46115691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 46128913 - 46128825
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
46128913 |
ggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
46128825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 53915683 - 53915771
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
53915683 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
53915771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 9446323 - 9446235
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| ||| |||||||||| ||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
9446323 |
ggctaaaatatgattttagtccctgtaaatatgtctcgttttggttttcgtccctgtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
9446235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 22584287 - 22584375
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||| |||||||||||||| |||||||| ||||| |||||||||||| ||||||||| |
|
|
| T |
22584287 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtctctgtaaaa--aaaatattgtttttggtctctgcaaaat |
22584375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 227 - 318
Target Start/End: Original strand, 47022743 - 47022834
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||| ||||||||||||||||| |||||| || | |||||||||||||||||||||||||| |
|
|
| T |
47022743 |
taaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctctaaaaaaaatttgttgtttttggtccctgcaaaatattt |
47022834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 53716921 - 53717009
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||| |||||||| |||| |||||| ||||||||||||||| |
|
|
| T |
53716921 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccttgtaaaaaaaaaa--ttgtttctggtccctgcaaaat |
53717009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 306
Target Start/End: Complemental strand, 8760781 - 8760700
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccc |
306 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||| |||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
8760781 |
ggctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctgtaaaaa-aaaaaattgtttttggtccc |
8760700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 222 - 307
Target Start/End: Complemental strand, 41324892 - 41324806
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta-aaaagaaaattttgtttttggtccct |
307 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||| |||||||||||||||||||| |||| ||||| ||||||||||||||| |
|
|
| T |
41324892 |
ttggctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaaatgttgtttttggtccct |
41324806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 55482470 - 55482381
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |||||||||||||||||||||||| ||| ||||||||||| |||| ||||| |
|
|
| T |
55482470 |
ttggctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggttcctgtaaaat |
55482381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 2180574 - 2180484
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| | | ||||||||||||||| |||||||| |||| || ||||||||||||||||||| |
|
|
| T |
2180574 |
ttggctaaaatatagttttagtccctgcaaatatggcacgttttggttttagtccttgtaaaaaaaaaa--ttatttttggtccctgcaaaat |
2180484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 222 - 283
Target Start/End: Original strand, 5827653 - 5827714
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5827653 |
ttggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaaa |
5827714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 22584607 - 22584521
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||| || |||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
22584607 |
ggctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaa----ttgtttttggtccctgcaaaat |
22584521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 229 - 318
Target Start/End: Complemental strand, 47532667 - 47532578
Alignment:
| Q |
229 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||| |||| |||||||||| ||| ||||||||||||| |||||||||| ||| | || ||||||||||||||||||||||| |
|
|
| T |
47532667 |
aaatatggttttggtccttgcaaatatgtctcgttttggttttagttcctgtaaaaaaaaattgttatttttggtccctgcaaaatattt |
47532578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 13530379 - 13530467
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| ||||| |||||||||||| |||||||| | |||||||||||||||||||| |
|
|
| T |
13530379 |
ggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgcaaaaagaatttgttgtttttggtccctgcaaa |
13530467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 13631599 - 13631511
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| ||||| | | |||||||||||||||||||| |
|
|
| T |
13631599 |
ggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
13631511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 31560331 - 31560419
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
31560331 |
ggctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
31560419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 41346218 - 41346129
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| | ||||||| |||| | ||||||||||||||||||| |
|
|
| T |
41346218 |
ggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccttggtaaaaaaaaaa--tcatttttggtccctgcaaaat |
41346129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 222 - 318
Target Start/End: Original strand, 5202924 - 5203025
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctc-attttggttttagtccct-gtaaaaagaaaat---tttgtttttggtccctgcaaaatat |
316 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||| ||||||||||||||||| ||||||| ||||| |||||||||||||| |||||||||| |
|
|
| T |
5202924 |
ttggttaaaatatggttttggtccctgcaaatatgcctcgtttttggttttagtccctagtaaaaaaaaaatttgtttgtttttggtccgtgcaaaatat |
5203023 |
T |
|
| Q |
317 |
tt |
318 |
Q |
| |
|
|| |
|
|
| T |
5203024 |
tt |
5203025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 222 - 285
Target Start/End: Complemental strand, 8191393 - 8191330
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||| |
|
|
| T |
8191393 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgtaaaaa |
8191330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 225 - 314
Target Start/End: Original strand, 13479273 - 13479359
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||| ||||| |||||| ||| |||||||||||||||| ||||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctataaaaaaaaa---ttgtttttggtccctgtaaaat |
13479359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 226 - 314
Target Start/End: Original strand, 16712331 - 16712421
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt--aaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||| |||||| |||| ||||| |||| |||||||||||||||||||||| |
|
|
| T |
16712331 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtattagtctctgtaaaaaaaaaaaaaattgtttttggtccctgcaaaat |
16712421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 24474600 - 24474690
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt-aaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| || ||||||||||||||| ||| ||||| |||| |||||||||| |||||||||||| |
|
|
| T |
24474600 |
ggctaaaatatggttttagtcc-tgcaaatatgcatcgttttggttttagtccatgtaaaaaaaaaaaatttgtttttgatccctgcaaaat |
24474690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 24474963 - 24474873
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||| |||| ||| |||||||||||| ||||| |
|
|
| T |
24474963 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctagtaaaaaaaaaaaattg-ttttggtccctgtaaaat |
24474873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 224 - 279
Target Start/End: Original strand, 35763647 - 35763702
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35763647 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35763702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 224 - 313
Target Start/End: Original strand, 45593228 - 45593314
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||| |||||| ||||||||||||||||| ||| | ||||||||||||||||||| |
|
|
| T |
45593228 |
ggctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtccctgtaaaaaaaaa---tagtttttggtccctgcaaaa |
45593314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 2034855 - 2034797
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2034855 |
ggctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctgtaa |
2034797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 4279022 - 4279111
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||| |||||||||||||||||||| ||| |||| ||||||||||||||| |||||| |
|
|
| T |
4279022 |
ggctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtccctgtataaa-aaaaaattgtttttggtccctacaaaat |
4279111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 313
Target Start/End: Complemental strand, 11693121 - 11693033
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattt--tgtttttggtccctgcaaaa |
313 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||| |||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
11693121 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctgtaaa---aaaatttgatgtttttggtccctgcaaaa |
11693033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 20144731 - 20144642
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||| || | |||||||||||||| ||||||||||| ||||||||||| ||| | |||||||||||||||||||||| |
|
|
| T |
20144731 |
ggctaaaatatggttttggttcatgcaaatatgcctcgttttggttttaacccctgtaaaaa-aaattgttgtttttggtccctgcaaaat |
20144642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 23779225 - 23779131
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
23779225 |
ggctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtccctgtcaattttttttgttgtttttggtccctgcaaaatattt |
23779131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 31812213 - 31812123
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||| |||||||||||||||||||||||| || | ||||||||||||| ||||||| |
|
|
| T |
31812213 |
ggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtcctggcaaaat |
31812123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 44925485 - 44925578
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||| | ||||||| ||| | |||||||||||||| ||||||||||| |
|
|
| T |
44925485 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtctcagtaaaaa-aaattgttgtttttggtccccgcaaaatattt |
44925578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 290
Target Start/End: Original strand, 45505600 - 45505666
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaa |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |||| |
|
|
| T |
45505600 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtgaaaaaaaaa |
45505666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 225 - 318
Target Start/End: Original strand, 2322094 - 2322187
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||| ||||||||||||| |||||||||| | |||||||||||||||||| ||||||| |
|
|
| T |
2322094 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtacctgtaaaaaatttttgttgtttttggtccctgcagaatattt |
2322187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 227 - 312
Target Start/End: Complemental strand, 5797817 - 5797732
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||| |||||| |||||||| ||| ||||||||||| |||||| ||||| ||| | |||||||||||||||||||| |
|
|
| T |
5797817 |
taaaatatggttttggtccctacaaatatgtctcgttttggttttaatccctgcaaaaaaaaattgttgtttttggtccctgcaaa |
5797732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 222 - 283
Target Start/End: Original strand, 13073757 - 13073818
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
13073757 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaa |
13073818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 227 - 312
Target Start/End: Complemental strand, 29499543 - 29499458
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
29499543 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaattttttgttgtttttggtccctgcaaa |
29499458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 225 - 318
Target Start/End: Complemental strand, 47136170 - 47136077
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||||| |||||||| | |||||||||||| || |||||||||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccttgtaaaaaatttttgttgtttttggtctctacaaaatattt |
47136077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 227 - 279
Target Start/End: Original strand, 15555506 - 15555558
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15555558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 226 - 290
Target Start/End: Complemental strand, 18205521 - 18205457
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaa |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||||||| |||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaaaaaaaaaa |
18205457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 28448834 - 28448925
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||| |||||||||||||| || |||| ||| | | |||||||||||||||||||||||| |
|
|
| T |
28448834 |
ggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagtctct---aaaaaaaattgtagtttttggtccctgcaaaatattt |
28448925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 222 - 310
Target Start/End: Complemental strand, 42824093 - 42824005
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgca |
310 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || ||||| ||||||||| |||||||| ||| | ||||||| |||||||||| |
|
|
| T |
42824093 |
ttggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagtccttgtaaaaaaaaattgttgttttaggtccctgca |
42824005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 224 - 280
Target Start/End: Complemental strand, 45505894 - 45505838
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgt |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
45505894 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
45505838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 215 - 282
Target Start/End: Complemental strand, 12791983 - 12791916
Alignment:
| Q |
215 |
ttttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||| | |||||||||||| |||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12791983 |
ttttatttaggctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtccctgtaa |
12791916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 227 - 282
Target Start/End: Original strand, 14791502 - 14791557
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtctctgtaa |
14791557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 224 - 283
Target Start/End: Complemental strand, 29380910 - 29380851
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |||||| |
|
|
| T |
29380910 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaaa |
29380851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 45474596 - 45474508
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||||| |||| | |||||| |||||||||||| |
|
|
| T |
45474596 |
ggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtctctgtaaaaaaaaaa--atatttttgatccctgcaaaat |
45474508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 224 - 279
Target Start/End: Complemental strand, 46088060 - 46088005
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
46088060 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
46088005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 224 - 308
Target Start/End: Original strand, 51708693 - 51708779
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg--taaaaagaaaattttgtttttggtccctg |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||| ||||| |||| |||||||||||||||| |
|
|
| T |
51708693 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtctctggtaaaaaaaaaaaaattgtttttggtccctg |
51708779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 217 - 318
Target Start/End: Original strand, 5797474 - 5797574
Alignment:
| Q |
217 |
ttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgt--ttttggtccctgcaaaat |
314 |
Q |
| |
|
|||| |||| ||||||||| |||| ||| ||||||||||| ||| |||||||||||||||||||||| |||||||||| ||||||||| |||||||| |
|
|
| T |
5797474 |
ttatcttggttaaaatatgattttggtctctgcaaatatgtctcgttttggttttagtccctgtaaa---aaaattttgttgttttggtccttgcaaaat |
5797570 |
T |
|
| Q |
315 |
attt |
318 |
Q |
| |
|
|||| |
|
|
| T |
5797571 |
attt |
5797574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 5827973 - 5827915
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
5827973 |
ggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctgtaa |
5827915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 225 - 283
Target Start/End: Complemental strand, 6353637 - 6353579
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
6353637 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgtaaa |
6353579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 278
Target Start/End: Complemental strand, 28809180 - 28809126
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
28809180 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccct |
28809126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 32208901 - 32208814
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||| ||||||||||| ||||||| ||| |||||||||||||| |||||| |
|
|
| T |
32208901 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagtccctagtaaaaaaaaa----tgtttttggtccctacaaaat |
32208814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 36702000 - 36702058
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
36702000 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
36702058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 41921084 - 41920995
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| || ||||||||||||||| | |||| |||| ||||||||||||||||||||||| |
|
|
| T |
41921084 |
ggctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagtcctaggtaaaa-aaaaatttgtttttggtccctgcaaaat |
41920995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 225 - 283
Target Start/End: Complemental strand, 51763201 - 51763143
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51763201 |
gctaaaatatagttttggtccctgcaaatatgcctcattttggttttagttcctgtaaa |
51763143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 53916047 - 53915953
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||| |||| |||| | |||||||||||||||||||||||||| |
|
|
| T |
53916047 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaaatttttttgttgtttttggtccctgcaaaatattt |
53915953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 54903475 - 54903417
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
54903475 |
ggctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaa |
54903417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 224 - 284
Target Start/End: Complemental strand, 34355283 - 34355223
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
34355283 |
ggctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtccctgtaaaa |
34355223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 223 - 279
Target Start/End: Original strand, 46292391 - 46292447
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
46292391 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
46292447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 47023105 - 47023017
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| |||||||||||||| || |||||||||||||||||| ||||| || | |||||| ||||||||||||| |
|
|
| T |
47023105 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtccctgcaaaaaaaatttgttgtttctggtccctgcaaa |
47023017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 227 - 295
Target Start/End: Original strand, 50822013 - 50822081
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttg |
295 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||||||||||||| ||| | ||||||||| |
|
|
| T |
50822013 |
taaaatatggttttagtccctgtaaatatgattcattttggttttagtccctgcaaacaaaaaattttg |
50822081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 226 - 312
Target Start/End: Original strand, 51830891 - 51830974
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||| ||||||||||||||| ||||| || |||||||||||||||||||||||| ||| ||||||||| |||||||||| |
|
|
| T |
51830891 |
ctaaaatatagttttagtccctgcatatatgtcttgttttggttttagtccctgtaaaaaaaaa---ttgtttttgatccctgcaaa |
51830974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 229 - 284
Target Start/End: Original strand, 2034544 - 2034599
Alignment:
| Q |
229 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
||||||| |||| ||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2034544 |
aaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaa |
2034599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 224 - 279
Target Start/End: Original strand, 4211561 - 4211616
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
4211561 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
4211616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 12152154 - 12152249
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgttttt-ggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||| ||||||||||||||||||| || | |||||||| |||| |||||||||||| |
|
|
| T |
12152154 |
ggctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtccctgtaaaaaaaatttgttgtttttctgtccttgcaaaatattt |
12152249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 224 - 279
Target Start/End: Complemental strand, 14791806 - 14791751
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
14791806 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
14791751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 224 - 283
Target Start/End: Original strand, 20291986 - 20292045
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
20291986 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtctctgtaaa |
20292045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 31370804 - 31370892
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| ||||||||||||| |||||||| |||| ||||||||||| |||||||||| |
|
|
| T |
31370804 |
ggctaaaatatggttttagtgtctgcgaatatgcctcgttttggttttagtttttgtaaaaaaaaaa--ttgtttttggttcctgcaaaat |
31370892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 215 - 318
Target Start/End: Complemental strand, 35119620 - 35119517
Alignment:
| Q |
215 |
ttttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||| | ||||||||||||||||| ||| ||||||||||| ||| ||||||||| ||||| | ||||| || | ||||||||||||| |||||||| |
|
|
| T |
35119620 |
ttttatataggctaaaatatggttttggtcactgcaaatatgtctcgttttggtttcagtccgtataaaacaaatttgttgtttttggtccttgcaaaat |
35119521 |
T |
|
| Q |
315 |
attt |
318 |
Q |
| |
|
|||| |
|
|
| T |
35119520 |
attt |
35119517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 224 - 279
Target Start/End: Complemental strand, 35763955 - 35763900
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
35763955 |
ggctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctg |
35763900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 227 - 314
Target Start/End: Original strand, 5063013 - 5063095
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||| ||||||||| |||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
5063013 |
taaaatatg-ttttagtccctgcaaatataccttgttttggtttaagtccctgtaaaaaaaa----ttgtttttggtccctgcaaaat |
5063095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 12152493 - 12152435
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||| |||||||||| |
|
|
| T |
12152493 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtccctgtaa |
12152435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 13074125 - 13074067
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||| ||||||||||||||| ||||| |
|
|
| T |
13074125 |
ggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccttgtaa |
13074067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 13764613 - 13764671
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||| ||||||||||| |
|
|
| T |
13764613 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctgtaa |
13764671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 278
Target Start/End: Complemental strand, 29420537 - 29420483
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct |
278 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
29420537 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
29420483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 35119292 - 35119350
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
35119292 |
ggctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtccctgtaa |
35119350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 225 - 283
Target Start/End: Complemental strand, 44925844 - 44925786
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||||||||||| ||| | ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44925844 |
gctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtccctgtaaa |
44925786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 224 - 285
Target Start/End: Complemental strand, 18136113 - 18136052
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
18136113 |
ggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctgtaaaaa |
18136052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 225 - 282
Target Start/End: Original strand, 36050289 - 36050346
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
36050289 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctgtaa |
36050346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 225 - 282
Target Start/End: Complemental strand, 37557194 - 37557137
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||| ||||| ||||||||||||||| |
|
|
| T |
37557194 |
gctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtccctgtaa |
37557137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 223 - 311
Target Start/End: Complemental strand, 43368778 - 43368692
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaa |
311 |
Q |
| |
|
||||||||||||||||||| | || ||||||||| || ||||||||||||| |||||||||| |||| ||||||||| ||||||||| |
|
|
| T |
43368778 |
tggctaaaatatggttttaattccggcaaatatgtttcgttttggttttagttcctgtaaaaaaaaaa--ttgtttttgatccctgcaa |
43368692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 224 - 285
Target Start/End: Complemental strand, 49123321 - 49123260
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49123321 |
ggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctgtaaaaa |
49123260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 2322432 - 2322344
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| ||||||||||||| |||||||| | | |||||||||||||||||||| |
|
|
| T |
2322432 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtgcctgtaaattgtttttgttgtttttggtccctgcaaa |
2322344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 225 - 315
Target Start/End: Original strand, 7639897 - 7639984
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaata |
315 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| || ||||||||||| || ||||||||| ||| ||| ||||||||||||||||||| |
|
|
| T |
7639897 |
gctaaaatatggttttggtccctacaaatatgtcttgttttggttttaatctctgtaaaaaaaaa---ttggttttggtccctgcaaaata |
7639984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 222 - 278
Target Start/End: Complemental strand, 8905236 - 8905180
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct |
278 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||| ||||| ||||| |
|
|
| T |
8905236 |
ttggctaaaatatggttttggtccctgtaaatatgcctcattttgattttaatccct |
8905180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 224 - 276
Target Start/End: Original strand, 14594206 - 14594258
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtcc |
276 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
14594206 |
ggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
14594258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 224 - 284
Target Start/End: Original strand, 27427872 - 27427931
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||| |||||||||||||||||| |||| |
|
|
| T |
27427872 |
ggctaaaatatggttt-agtccctgcaaatatggctcgttttggttttagtccctgcaaaa |
27427931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 227 - 279
Target Start/End: Original strand, 30060772 - 30060824
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
30060772 |
taaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtccctg |
30060824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 226 - 318
Target Start/End: Original strand, 30564835 - 30564927
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||||||||| | ||||||||||| |||||||||||||||| |
|
|
| T |
30564835 |
ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtccctgtagatttttgtttttgtttttgatccctgcaaaatattt |
30564927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 41920766 - 41920818
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
274 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
41920766 |
ttggttaaaatatggttttagtccctgcaaatatgactcattttgattttagt |
41920818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 227 - 282
Target Start/End: Original strand, 20144423 - 20144478
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||| ||||||| |||||||| |
|
|
| T |
20144423 |
taaaatatggttttggtccctgcaaatatgcctcgttttagttttagaccctgtaa |
20144478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 224 - 279
Target Start/End: Original strand, 26412190 - 26412245
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
26412190 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
26412245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 224 - 279
Target Start/End: Original strand, 29380668 - 29380723
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
29380668 |
ggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttggtccctg |
29380723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 224 - 283
Target Start/End: Complemental strand, 31182504 - 31182445
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| ||| ||||||||| |||||||||||| |
|
|
| T |
31182504 |
ggctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtccctgtaaa |
31182445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 224 - 283
Target Start/End: Original strand, 42823776 - 42823835
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||||||||||| |||||||| |
|
|
| T |
42823776 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtacctgtaaa |
42823835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 227 - 282
Target Start/End: Complemental strand, 54208822 - 54208767
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| |||||||||||||| |||||| |
|
|
| T |
54208822 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaa |
54208767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 225 - 275
Target Start/End: Complemental strand, 15555637 - 15555587
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
275 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
15555637 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtc |
15555587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 19903261 - 19903319
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||| ||||| |||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
19903261 |
ggctaaaatatagttttgatccctgcaaatatgtctcattttgattttagtccctgtaa |
19903319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 26314332 - 26314274
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| ||| ||||||||||||||||||||| |
|
|
| T |
26314332 |
ggctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctgtaa |
26314274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 222 - 272
Target Start/End: Original strand, 29463608 - 29463658
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
272 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||| ||||||||||| |
|
|
| T |
29463608 |
ttggctaaaatatggttttatttcctgcaaatatgcctcgttttggtttta |
29463658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 31811925 - 31811983
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
31811925 |
ggctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtccctgtaa |
31811983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 37556841 - 37556899
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||||| || ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
37556841 |
ggctaaaatatggttttagaccttgcaaatatacctcgatttggttttagtccctgtaa |
37556899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 265 - 314
Target Start/End: Complemental strand, 5063323 - 5063274
Alignment:
| Q |
265 |
tggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
5063323 |
tggttttagtccctgtaaaataaaaaatttgtttttggtccctgcaaaat |
5063274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 25358542 - 25358485
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||||||||||||| |||| ||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
25358542 |
ttggctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccctg |
25358485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 231 - 312
Target Start/End: Complemental strand, 27428195 - 27428114
Alignment:
| Q |
231 |
atatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||| | |||||||||||| |||||||| ||||||||| ||||| ||| ||| | || |||||| |||||||||| |
|
|
| T |
27428195 |
atatggttttaatacctgcaaatatgtctcattttcgttttagtctctgtataaaaaaattgttatttttgatccctgcaaa |
27428114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 227 - 314
Target Start/End: Original strand, 49123000 - 49123082
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||| || |||||||| || ||||||||||||| |||||||||| ||| || ||||||||||||||||||| |
|
|
| T |
49123000 |
taaaatatggttttagtcc-tgtaaatatgcttcgttttggttttagt-cctgtaaaaaaaaa---ttatttttggtccctgcaaaat |
49123082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 265 - 314
Target Start/End: Original strand, 55482146 - 55482194
Alignment:
| Q |
265 |
tggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
55482146 |
tggttttagtccctgtaaaaa-aaaaatttgtttttggtccctgcaaaat |
55482194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 224 - 272
Target Start/End: Original strand, 8904886 - 8904934
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
272 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
8904886 |
ggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 10078190 - 10078242
Alignment:
| Q |
157 |
tcatgaagttgtgtattttgaaaaggacgatcaactttcaacctaagtaacaa |
209 |
Q |
| |
|
|||| ||||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
10078190 |
tcataaagttgtgtatgttgaaaaggacaatcaactttcaatctaagtaacaa |
10078242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 219 - 279
Target Start/End: Original strand, 19321565 - 19321625
Alignment:
| Q |
219 |
atgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||| |||| ||||||| ||| ||||||| |||||||||||||||||| |
|
|
| T |
19321565 |
atgtaggctaaaatatgattttggtccctgtaaacatgcctcgttttggttttagtccctg |
19321625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 222 - 282
Target Start/End: Original strand, 26313986 - 26314046
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
26313986 |
ttggctaaaatatggttttgatccctgcaaatatgttccgttttggttttagtccctgtaa |
26314046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 226 - 282
Target Start/End: Complemental strand, 35420701 - 35420645
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||| |||| |||||||||| ||| |||||||||||||||||||| |
|
|
| T |
35420701 |
ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctgtaa |
35420645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 47274232 - 47274180
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
274 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||| ||| ||||||||||||| |
|
|
| T |
47274232 |
ttggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
47274180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 224 - 283
Target Start/End: Complemental strand, 13764807 - 13764748
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| || ||||||||||||||| |||||| |
|
|
| T |
13764807 |
ggctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagtccatgtaaa |
13764748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 226 - 281
Target Start/End: Original strand, 35420393 - 35420448
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta |
281 |
Q |
| |
|
||||||||||||||| ||||| |||||||||| | |||||||||||||||||||| |
|
|
| T |
35420393 |
ctaaaatatggttttggtccccgcaaatatgctttgttttggttttagtccctgta |
35420448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 227 - 318
Target Start/End: Original strand, 50753925 - 50754016
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||| |||||||||||||| || ||||||||||||| |||||||| | |||||||||||||||||||||||||| |
|
|
| T |
50753925 |
taaaatatggttttggtccctgcaaatatatcttgttttggttttagttcctgtaaatttcttttgttgtttttggtccctgcaaaatattt |
50754016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 224 - 279
Target Start/End: Complemental strand, 51738411 - 51738356
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||| ||||| |||| ||||||| |
|
|
| T |
51738411 |
ggctaaaatatggttttggtccatgcaaatatgcctcgttttgattttggtccctg |
51738356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 5797747 - 5797705
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5797747 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
5797705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 11692762 - 11692816
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct |
278 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||| | ||||| ||||||||||| |
|
|
| T |
11692762 |
ggctaaaatgtggttttggtccctgcaaatatgccccgttttgattttagtccct |
11692816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 13530452 - 13530494
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13530452 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
13530494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 227 - 314
Target Start/End: Original strand, 18135793 - 18135874
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||| || |||||||| || ||||||||||||| |||||||||| || || ||||||||||||||||||| |
|
|
| T |
18135793 |
taaaatatggttttagtcc-tgtaaatatgcttcgttttggttttagt-cctgtaaaaaaaa----ttatttttggtccctgcaaaat |
18135874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #208
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 24774354 - 24774312
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24774354 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
24774312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #209
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 25424239 - 25424197
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25424239 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
25424197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #210
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 265 - 314
Target Start/End: Complemental strand, 31370990 - 31370943
Alignment:
| Q |
265 |
tggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
31370990 |
tggttttagtccctgtaaaaaaaaa--tttgtttttggtccctgcaaaat |
31370943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #211
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 31811996 - 31812038
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31811996 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
31812038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #212
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 227 - 290
Target Start/End: Original strand, 34354972 - 34355031
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaa |
290 |
Q |
| |
|
|||||||| ||||||||||||||| |||||| |||||||||||||||||||||||| |||| |
|
|
| T |
34354972 |
taaaatatagttttagtccctgca----tgcctcgttttggttttagtccctgtaaaaaaaaaa |
34355031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #213
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 47135851 - 47135893
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47135851 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
47135893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #214
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 51763129 - 51763087
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
51763129 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
51763087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #215
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 225 - 318
Target Start/End: Original strand, 12791610 - 12791703
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||| |||||||||| | ||| |||||||||||||||||||||||||||| |
|
|
| T |
12791610 |
gctaaaatatagttttagtccctgcaaatatgtgccattttcgttttagtccttataatgttttttttttgtttttggtccctgcaaaatattt |
12791703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #216
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 242 - 279
Target Start/End: Complemental strand, 47023027 - 47022990
Alignment:
| Q |
242 |
gtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47023027 |
gtccctgcaaatatgcctcattttggttttggtccctg |
47022990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #217
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 227 - 312
Target Start/End: Original strand, 47135781 - 47135866
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||| ||| |||| ||| ||| |||||| ||| ||||||||||||| |||||||||| || | |||||||||||||||||||| |
|
|
| T |
47135781 |
taaaacatgattttggtctctgtaaatatatctcgttttggttttagttcctgtaaaaaaaatttgttgtttttggtccctgcaaa |
47135866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #218
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 242 - 279
Target Start/End: Complemental strand, 54208747 - 54208710
Alignment:
| Q |
242 |
gtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
54208747 |
gtccctgcaaatatgcctcattttggttttggtccctg |
54208710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #219
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 237 - 277
Target Start/End: Complemental strand, 2034781 - 2034741
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccc |
277 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2034781 |
ttttggtccctgcaaatatgtctcattttggttttagtccc |
2034741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #220
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 285
Target Start/End: Original strand, 8191076 - 8191136
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||| || |||| ||||||||||||||||||| |
|
|
| T |
8191076 |
gctaaaatatgattttaatccctacaaatatgtcttgttttagttttagtccctgtaaaaa |
8191136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #221
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 240 - 312
Target Start/End: Complemental strand, 17865345 - 17865273
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| | ||||| |||| ||||||||||| |
|
|
| T |
17865345 |
tagtccctgcaaatatctgacattttggttttagtccctgtaaaaatatttttttggttttagtccctgcaaa |
17865273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #222
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 265 - 312
Target Start/End: Original strand, 18830887 - 18830932
Alignment:
| Q |
265 |
tggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
18830887 |
tggttttagtccctgtaaaaaaaaaa--ttgtttttggtccctgcaaa |
18830932 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #223
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 228 - 276
Target Start/End: Complemental strand, 20292284 - 20292237
Alignment:
| Q |
228 |
aaaatatggttttagtccctgcaaatatgcctcattttggttttagtcc |
276 |
Q |
| |
|
||||||| ||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
20292284 |
aaaatatcgttttggtccctgcaa-tatgcctcattttggttttagtcc |
20292237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #224
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 224 - 272
Target Start/End: Original strand, 52543422 - 52543470
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
272 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||| ||||||||||| |
|
|
| T |
52543422 |
ggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #225
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 246 - 285
Target Start/End: Original strand, 29420231 - 29420270
Alignment:
| Q |
246 |
ctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
29420231 |
ctgcaaatatgtctcattttggttttagtccttgtaaaaa |
29420270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #226
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 230 - 309
Target Start/End: Original strand, 31182133 - 31182210
Alignment:
| Q |
230 |
aatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgc |
309 |
Q |
| |
|
||||||||||| || ||||||||||| |||||||| ||||||| |||||||||| ||| | ||||||||||||||||| |
|
|
| T |
31182133 |
aatatggttttggttagtgcaaatatgcttcattttgattttagt-cctgtaaaaa-aaattgttgtttttggtccctgc |
31182210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #227
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 227 - 318
Target Start/End: Original strand, 54903114 - 54903205
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||| ||||| ||||||||| || |||| |||||| | ||||||||| || | ||||||||| |||| ||||||||||| |
|
|
| T |
54903114 |
taaaatatggttttgatccctacaaatatgcatcgttttagttttaattcctgtaaaacaaatttgttgtttttgatccccgcaaaatattt |
54903205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #228
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 271
Target Start/End: Complemental strand, 5203220 - 5203186
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggtttt |
271 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
5203220 |
ttttggtccctgcaaatatgcctcattttggtttt |
5203186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #229
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 7642580 - 7642538
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
7642580 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
7642538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #230
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 7642652 - 7642594
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||| || | ||| ||||||||||| || ||||||||||||||||||||| |
|
|
| T |
7642652 |
ggctaaaatatgattatggtctctgcaaatatgtttcgttttggttttagtccctgtaa |
7642594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #231
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 14488114 - 14488072
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
14488114 |
ttttggtccctgcaaatatgcttcattttggttttggtccctg |
14488072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #232
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 222 - 300
Target Start/End: Original strand, 22204053 - 22204131
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgttttt |
300 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| | ||| |||||||||||||| |||| |||| ||||||||| |
|
|
| T |
22204053 |
ttggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctggtaaaaaaaaaatttgttttt |
22204131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #233
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 23245304 - 23245346
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
23245304 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
23245346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #234
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 26412511 - 26412469
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
26412511 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
26412469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #235
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 28449214 - 28449156
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||| ||||| ||||| ||| ||||| |
|
|
| T |
28449214 |
ggctaaaatatggttttggtccttgcaaatatgtctcgttttgattttaatccatgtaa |
28449156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #236
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 29499473 - 29499431
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
29499473 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
29499431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #237
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 30060842 - 30060884
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
30060842 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
30060884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #238
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 31560404 - 31560446
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
31560404 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
31560446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #239
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 35464309 - 35464267
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
35464309 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
35464267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #240
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 36050359 - 36050401
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
36050359 |
ttttggtccctgcaaatatgcctcgttttggttttggtccctg |
36050401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #241
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 42848318 - 42848276
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
42848318 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
42848276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #242
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 43231161 - 43231203
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
43231161 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
43231203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #243
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 46115706 - 46115664
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
46115706 |
ttttggtccctgcaaatatgccttattttggttttggtccctg |
46115664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #244
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 46128840 - 46128798
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
46128840 |
ttttggtccctgcaaatatgccttattttggttttggtccctg |
46128798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #245
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 53915756 - 53915798
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
53915756 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
53915798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #246
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 231 - 318
Target Start/End: Complemental strand, 3653733 - 3653647
Alignment:
| Q |
231 |
atatggttttagtccctgcaaatatgcctcattttggttttagtc-cctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||| |||||||||||| |||||| ||| |||||||||||||| || ||||||| |||| |||||||| ||||||| |||| |||| |
|
|
| T |
3653733 |
atatgattttagtccctgtaaatataccttgttttggttttagtctccggtaaaaaaaaaa--ttgtttttagtccctgtaaaaaattt |
3653647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #247
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 238 - 271
Target Start/End: Complemental strand, 6353564 - 6353531
Alignment:
| Q |
238 |
tttagtccctgcaaatatgcctcattttggtttt |
271 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
6353564 |
tttagcccctgcaaatatgcctcattttggtttt |
6353531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #248
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 265 - 314
Target Start/End: Complemental strand, 11285825 - 11285776
Alignment:
| Q |
265 |
tggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||| |||| || |||||||||||| |||||| |
|
|
| T |
11285825 |
tggttttagtccctgtaaaaaaaaaaaattatttttggtccctacaaaat |
11285776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #249
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 259 - 312
Target Start/End: Original strand, 12792605 - 12792658
Alignment:
| Q |
259 |
tcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||| |||| ||||||||||| |
|
|
| T |
12792605 |
tcattttggttttagtccctgtaaaaatatttttttgattttagtccctgcaaa |
12792658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #250
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 282
Target Start/End: Original strand, 25358213 - 25358270
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||| ||||| ||| ||||||||||| || ||||||||| ||||| ||||| |
|
|
| T |
25358213 |
gctaaaatatgattttaatccatgcaaatatgcttcgttttggtttcagtccttgtaa |
25358270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #251
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 234 - 279
Target Start/End: Complemental strand, 25358499 - 25358454
Alignment:
| Q |
234 |
tggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||| | ||||||| |
|
|
| T |
25358499 |
tggttttagtccctgcaaatatgtctcgttttggttgtggtccctg |
25358454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #252
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 282
Target Start/End: Original strand, 30890832 - 30890889
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||| | |||||||||||||| || ||||| |||||||||| ||||| |
|
|
| T |
30890832 |
gctaaaatatggttatgatccctgcaaatatgtcttattttagttttagtccatgtaa |
30890889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #253
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 242 - 305
Target Start/End: Original strand, 43199992 - 43200052
Alignment:
| Q |
242 |
gtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtcc |
305 |
Q |
| |
|
||||||| |||||||| |||||||||||||||| ||||||||| ||| ||||||||||||| |
|
|
| T |
43199992 |
gtccctgtaaatatgcttcattttggttttagtttctgtaaaaaaaaa---ttgtttttggtcc |
43200052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #254
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 234 - 271
Target Start/End: Original strand, 43231189 - 43231226
Alignment:
| Q |
234 |
tggttttagtccctgcaaatatgcctcattttggtttt |
271 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
43231189 |
tggttttggtccctgcaaatatgtctcattttggtttt |
43231226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #255
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 265 - 314
Target Start/End: Original strand, 46087799 - 46087848
Alignment:
| Q |
265 |
tggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||| | || |||| |||||||||||||||||||||||||||| |
|
|
| T |
46087799 |
tggttttagttcttggtaaaaaaaaattttgtttttggtccctgcaaaat |
46087848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #256
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 276
Target Start/End: Complemental strand, 55805089 - 55805036
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtcc |
276 |
Q |
| |
|
|||||||||||| ||||| || | ||||||||||||| ||||||||||||||| |
|
|
| T |
55805089 |
tggctaaaatatagttttggttcttgcaaatatgccttgttttggttttagtcc |
55805036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #257
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 261 - 293
Target Start/End: Original strand, 12904784 - 12904816
Alignment:
| Q |
261 |
attttggttttagtccctgtaaaaagaaaattt |
293 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
12904784 |
attttggttttagtccctgtaaaaaaaaaattt |
12904816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #258
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 243 - 279
Target Start/End: Original strand, 19903340 - 19903376
Alignment:
| Q |
243 |
tccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
19903340 |
tccctgcaaatatgtctcattttggttttggtccctg |
19903376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #259
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 223 - 255
Target Start/End: Complemental strand, 22205282 - 22205250
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatat |
255 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
22205282 |
tggctaaaatatgcttttagtccctgcaaatat |
22205250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #260
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 284
Target Start/End: Original strand, 26314490 - 26314534
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26314490 |
tagtccctgcaaatatctgacattttggttttagtccctgtaaaa |
26314534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #261
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 240 - 312
Target Start/End: Original strand, 32592757 - 32592829
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||| | ||||| |||| ||||||||||| |
|
|
| T |
32592757 |
tagtccctgcaaatatttgacattttggttttagtccttgtaaaaatatttttttggttttagtccctgcaaa |
32592829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #262
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 227 - 255
Target Start/End: Complemental strand, 51831002 - 51830974
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatat |
255 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
51831002 |
taaaatatggttttagtccctgcaaatat |
51830974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #263
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 226 - 282
Target Start/End: Complemental strand, 52543725 - 52543669
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||| |||| || | |||||||||||||| ||||||||||| ||| ||||| |
|
|
| T |
52543725 |
ctaaaatatgattttggttcttgcaaatatgcctcgttttggttttaatccatgtaa |
52543669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 83; Significance: 3e-39; HSPs: 274)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 21159817 - 21159727
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21159817 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaagaaaattttgtttttggtccctgcaaaat |
21159727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 19844581 - 19844487
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
19844581 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
19844487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 12673644 - 12673734
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12673644 |
ggctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctgtaaaaataaaattttgtttttggtccctgcaaaat |
12673734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 22008526 - 22008620
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| | ||||||||||||| |||||||||||| |
|
|
| T |
22008526 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaagaaattgttgtttttggtccttgcaaaatattt |
22008620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 22016044 - 22016138
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| | ||||||||||||| |||||||||||| |
|
|
| T |
22016044 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaaaaagaaattgttgtttttggtccttgcaaaatattt |
22016138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 223 - 317
Target Start/End: Original strand, 49323781 - 49323875
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatatt |
317 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
49323781 |
tggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt |
49323875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 224 - 317
Target Start/End: Original strand, 31480136 - 31480229
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatatt |
317 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
31480136 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt |
31480229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 222 - 314
Target Start/End: Original strand, 8510212 - 8510304
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
8510212 |
ttggctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaat |
8510304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 223 - 314
Target Start/End: Original strand, 29445953 - 29446044
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| || |||| ||||||||||||||||||||||| |
|
|
| T |
29445953 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaacaaaaaaaatttgtttttggtccctgcaaaat |
29446044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 21159453 - 21159543
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||| ||||||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21159453 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaaaaagaaaattttgtttttggtccctgtaaaat |
21159543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 226 - 312
Target Start/End: Original strand, 29955300 - 29955386
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaacttttgtttttggtccctgcaaa |
29955386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 226 - 312
Target Start/End: Original strand, 30004454 - 30004540
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaaaaaaaaacttttgtttttggtccctgcaaa |
30004540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 39437109 - 39437019
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
39437109 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaat |
39437019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 47336581 - 47336487
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
47336581 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
47336487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 54608863 - 54608769
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
54608863 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
54608769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 224 - 317
Target Start/End: Complemental strand, 12741271 - 12741178
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatatt |
317 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
12741271 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt |
12741178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 225 - 314
Target Start/End: Complemental strand, 22156292 - 22156203
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
22156292 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaat |
22156203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 224 - 317
Target Start/End: Complemental strand, 45002385 - 45002292
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatatt |
317 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||| |||||||||||||||||||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
45002385 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatatt |
45002292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 224 - 313
Target Start/End: Original strand, 51834608 - 51834696
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
51834608 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaa-aaaattttgtttttggtccctgcaaaa |
51834696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 226 - 314
Target Start/End: Original strand, 14633547 - 14633635
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
14633547 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaggccctggtaaaaaaaaattttgtttttggtccctgcaaaat |
14633635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 226 - 318
Target Start/End: Complemental strand, 45006247 - 45006155
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||||| |||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
45006155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 4950037 - 4950125
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |||||||||||||| |||||||| |
|
|
| T |
4950037 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaa--aaaaatttgtttttggtccttgcaaaat |
4950125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 223 - 318
Target Start/End: Complemental strand, 26090079 - 26089984
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| ||| | |||||||||||||||| ||||||||| |
|
|
| T |
26090079 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgtaaaatattt |
26089984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 3152111 - 3152022
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
3152111 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaa-aaaaatttgtttttggtccctgcaaaat |
3152022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 3830516 - 3830426
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |||| ||||||||||||| |||||||| |
|
|
| T |
3830516 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaaaattgtttttggtccttgcaaaat |
3830426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 4513263 - 4513348
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
4513263 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaa |
4513348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 5345689 - 5345600
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |||| |||||||||| |||||||||||| |
|
|
| T |
5345689 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaaaaa-aaaaatttgtttttgatccctgcaaaat |
5345600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 13584367 - 13584277
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
13584367 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaat |
13584277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 39436718 - 39436811
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
39436718 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaa-aaaaatttgtttttggtccctgcaaaatattt |
39436811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 46186771 - 46186681
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||| ||||||||| |||| |||||||||||||| |||||||| |
|
|
| T |
46186771 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtctctgtaaaaaaaaaaatttgtttttggtccttgcaaaat |
46186681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 3830134 - 3830220
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||| |
|
|
| T |
3830134 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaaaaa----ttgtttttggtccttgcaaaat |
3830220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 3151750 - 3151839
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
3151750 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctagtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
3151839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 222 - 318
Target Start/End: Original strand, 9261787 - 9261883
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||||||||||||||||||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
9261787 |
ttggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaacaaatttgttgtttttggtccctgcaaaatattt |
9261883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 28427608 - 28427519
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
28427608 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
28427519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 40169656 - 40169564
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||| |||| ||||||||||||||||||||| |||||| |
|
|
| T |
40169656 |
ttggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctggtaaaaaaaaattttgtttttggtcccttcaaaat |
40169564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 222 - 318
Target Start/End: Original strand, 44802280 - 44802375
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||||| ||| | |||||||||||||||| ||||||||| |
|
|
| T |
44802280 |
ttggctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcctgtaaaaaaaaattgttgtttttggtccctg-aaaatattt |
44802375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 30130158 - 30130246
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
30130158 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
30130246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 45320979 - 45320891
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |||| |||||||||| |||||||||||| |
|
|
| T |
45320979 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaa--aaaaatttgtttttgatccctgcaaaat |
45320891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 226 - 311
Target Start/End: Original strand, 50196301 - 50196383
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaa |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaa---tgtttttggtccctgcaa |
50196383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 51500685 - 51500597
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| ||||| |||| |||||||||||||||||||||| |
|
|
| T |
51500685 |
ggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaaaa--ttgtttttggtccctgcaaaat |
51500597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 7518090 - 7518179
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||| |||||||||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
7518090 |
ggctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagtccttgtaaaaa-aaagttttgtttttggtccctgcaaaat |
7518179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 10977341 - 10977247
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||| |||||||||||||||||| |||| | || ||||||||||||||||||||||||||| |
|
|
| T |
10977341 |
ggctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaagaaatttgtttttggtccctgcaaaatattt |
10977247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 222 - 314
Target Start/End: Original strand, 15016386 - 15016475
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| ||| |||||||||||||||||||||| |
|
|
| T |
15016386 |
ttggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtgaaaaaaaa---ttgtttttggtccctgcaaaat |
15016475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 15979701 - 15979608
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| ||| |||||||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
15979701 |
ggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaaaaa-aaattgttgtttttggtccctgcaaaatattt |
15979608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 22155929 - 22156019
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
22155929 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaat |
22156019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 26799888 - 26799978
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
26799888 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaat |
26799978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 28552021 - 28552115
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
28552021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctgtaaaaaaattttgttgtttttggtccctgcaaaatattt |
28552115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 313
Target Start/End: Complemental strand, 31869956 - 31869869
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||| ||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
31869956 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgtaaaaaaaaaa--ttgtttttggtccctgcaaaa |
31869869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 51759819 - 51759909
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||| |||| |||||||||||| ||| |||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
51759819 |
ggctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaaaaattgtttttggtccctgcaaaat |
51759909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 223 - 312
Target Start/End: Original strand, 4034716 - 4034805
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| || | |||||||||||||||||||| |
|
|
| T |
4034716 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
4034805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 9262155 - 9262066
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||| | ||||| |||||| |||||||||||||||||||| |
|
|
| T |
9262155 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccccgcaaaaaaaaaattgttgtttttggtccctgcaaa |
9262066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 223 - 314
Target Start/End: Original strand, 10976977 - 10977067
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||| |||||| ||||||||||||||| |
|
|
| T |
10976977 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttctggtccctgcaaaat |
10977067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 223 - 304
Target Start/End: Complemental strand, 25710871 - 25710791
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtc |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
25710871 |
tggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaa-aaaaaattgtttttggtc |
25710791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 224 - 311
Target Start/End: Original strand, 37506867 - 37506953
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaa |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |||| ||||||||||||||||||| |
|
|
| T |
37506867 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaa |
37506953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 37507222 - 37507136
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
37507222 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgataaaaaaaaa--ttgtttttggtccctgcaaa |
37507136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 40370589 - 40370500
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||| | ||||| |||||| |||||||||||||||||||| |
|
|
| T |
40370589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccccgcaaaaaaaaaattgttgtttttggtccctgcaaa |
40370500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 52342583 - 52342494
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||| ||||||||||||||| |||||||| |||||| |||||||||||||||||||| |
|
|
| T |
52342583 |
ggctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagtccatgtaaaaaaaaaattgttgtttttggtccctgcaaa |
52342494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 9603629 - 9603717
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |||||| ||| | |||||||||||||||||||| |
|
|
| T |
9603629 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctataaaaaaaaattgttgtttttggtccctgcaaa |
9603717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 227 - 314
Target Start/End: Original strand, 20757403 - 20757488
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||||||| |||||| |||| |||||||||||||||||||||| |
|
|
| T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctataaaaaaaaaa--ttgtttttggtccctgcaaaat |
20757488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 51550082 - 51550170
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
51550082 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
51550170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 4513620 - 4513532
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||||||||||||| | || |||||||||||||||||||||| |
|
|
| T |
4513620 |
ggctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaacaa--ttgtttttggtccctgcaaaat |
4513532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 9603919 - 9603829
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| || |||| |||||||| || |||||||||||||||||||||| |
|
|
| T |
9603919 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttattctctgt-aaaagaaatttgttgtttttggtccctgcaaaat |
9603829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 227 - 314
Target Start/End: Complemental strand, 20907454 - 20907368
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
20907454 |
taaaatatggttttaatccctgcaaatatgcctcattttggttttagtctctgtgaaaa-aaaaaattgtttttggtccctgcaaaat |
20907368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 29955666 - 29955571
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatttt-----gtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
29955666 |
ggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaaattttttgtagtttttggtccctgcaaaat |
29955571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 30004821 - 30004726
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatttt-----gtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
30004821 |
ggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaaaaaaaaaattttttgtagtttttggtccctgcaaaat |
30004726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 227 - 318
Target Start/End: Complemental strand, 35569133 - 35569042
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| || | ||||||||||||| |||||||||||| |
|
|
| T |
35569133 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgcaaaatattt |
35569042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 46751271 - 46751359
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||||| |||| |||||||||||||| |||||||| |
|
|
| T |
46751271 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccttgtaaaa--aaaaatttgtttttggtccttgcaaaat |
46751359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 224 - 313
Target Start/End: Complemental strand, 51834942 - 51834854
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||| |||| ||||||||||||||||||||| |
|
|
| T |
51834942 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaaaa |
51834854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 9863404 - 9863315
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |||| | ||||||||||| |||||||| |
|
|
| T |
9863404 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaaaaa-aaaaaatagtttttggtccttgcaaaat |
9863315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 222 - 312
Target Start/End: Original strand, 26089728 - 26089818
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| || |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
26089728 |
ttggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
26089818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 28452147 - 28452241
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| || ||||||||||||||| |||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
28452147 |
ggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtccttgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
28452241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 223 - 312
Target Start/End: Complemental strand, 39072214 - 39072127
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| ||||| ||||| |||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
39072214 |
tggctaaaatatggttttagttcctgcaaatatgcctcgttttgattttaatccctgtaaaaaaaaaa--ttgtttttggtccctgcaaa |
39072127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 43441603 - 43441509
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||| | | |||||||||||||||||||||||||| |
|
|
| T |
43441603 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaaatattt |
43441509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 222 - 314
Target Start/End: Original strand, 53701359 - 53701448
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||| ||||| ||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
53701359 |
ttggctaaaatatggttttaatctctgcaaatatgccttattttagttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
53701448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 225 - 314
Target Start/End: Complemental strand, 3361817 - 3361728
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| ||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
3361817 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtctctggtaaaaaaaaaaattgtttttggtccctgcaaaat |
3361728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 222 - 314
Target Start/End: Original strand, 16123137 - 16123230
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta-aaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |||| |||| ||||||||| |||||| ||||| |
|
|
| T |
16123137 |
ttggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgtacaaaaaaaaaaattgtttttgatccctgtaaaat |
16123230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 20612898 - 20612812
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| |||| |||||||||||||| |||||| |
|
|
| T |
20612898 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctggtaaa--aaaaatttgtttttggtccttgcaaa |
20612812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 38232241 - 38232337
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt--ttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||| ||||||||| |||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
38232241 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagtccttgtaaaaaaaaaatttgttgtttttggtccctgcaaaatattt |
38232337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 223 - 316
Target Start/End: Original strand, 40370284 - 40370377
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatat |
316 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||| |||||||| |||||||||| ||| | |||||||||||||||||||||||| |
|
|
| T |
40370284 |
tggctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagttcctgtaaaaaaaaattgttgtttttggtccctgcaaaatat |
40370377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 275444 - 275531
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| ||||| |||||||||||| ||||| ||| |||||||||||||||||||||| |
|
|
| T |
275444 |
ggctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtccctgcaaaaaaaaa---ttgtttttggtccctgcaaaat |
275531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 9597095 - 9597007
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || |||||||||||||||||||||||| || | |||||||||||||||||||| |
|
|
| T |
9597095 |
ggctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
9597007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 19656541 - 19656628
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||| ||||||||| |||||||| |||| |||||||||||||||||||| |
|
|
| T |
19656541 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccttgtaaaaa-aaaaaattgtttttggtccctgcaaa |
19656628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 221 - 308
Target Start/End: Original strand, 19844262 - 19844350
Alignment:
| Q |
221 |
gttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctg |
308 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||| |||| |||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
19844262 |
gttggctaaaatatggttttggtccctacaaatatgcctcgttttaattttagtccctgtaaaaaaaaaattgttgtttttggtccctg |
19844350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 20611020 - 20611109
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| || ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
20611020 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtctctggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
20611109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 28942905 - 28942816
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||||||||| ||||||| |||| |||||||||||| ||||||||| |
|
|
| T |
28942905 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtctctgcaaaat |
28942816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 226 - 318
Target Start/End: Original strand, 30034109 - 30034201
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||| ||||||||||| ||| |||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
30034109 |
ctaaaatatggttttggtccttgtaaatatgcctcgttttggttttaatccttgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
30034201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 32119584 - 32119496
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
32119584 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
32119496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 34238598 - 34238687
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||| | ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
34238598 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
34238687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 227 - 314
Target Start/End: Original strand, 45161116 - 45161201
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||||||||||||| ||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
45161116 |
taaaatatggtttaagtccctgcaaatatgtctcgttttggttttagtctctgtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
45161201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 4814540 - 4814628
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||| || ||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
4814540 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttattctgtgtaaaa--aaaagtttgtttttggtccctgcaaaat |
4814628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 39288898 - 39288810
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |||| |||| ||| |||||||||||||||||| |
|
|
| T |
39288898 |
ggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaa--ttgattttggtccctgcaaaat |
39288810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 224 - 311
Target Start/End: Original strand, 40169344 - 40169431
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaa |
311 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| ||||| |||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
40169344 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccctggtaaaaaaaaaatttgtttttggtccctgcaa |
40169431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 863281 - 863375
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||| |||| |||| |||||||||| ||| |||| ||||||||| ||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
863281 |
ggctaaaatatgattttggtccatgcaaatatgtctcgttttagttttagtctctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
863375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 227 - 317
Target Start/End: Original strand, 8940163 - 8940253
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatatt |
317 |
Q |
| |
|
|||||||||||||| || |||||||||| |||| |||||||||||||||||||||||| || | ||||||||||||||||||||||||| |
|
|
| T |
8940163 |
taaaatatggttttgatctctgcaaatatacctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatatt |
8940253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 25609767 - 25609860
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||| | |||||| ||||| |||||||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
25609767 |
ggctaaaatatggttttggtctttacaaataagcctcgttttggttttagtccctgtaaaaa-aaattgttgtttttggtccctgcaaaatattt |
25609860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 28427245 - 28427335
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||| |||||||||||||||||| |||| |||| |||||||||||| |||| ||||| |
|
|
| T |
28427245 |
ggctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggttcctgtaaaat |
28427335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 29686870 - 29686776
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||| ||||| ||||||||||| ||| || |||||||||||||| |||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
29686870 |
ggctaaaatatagttttgatccctgcaaatgtgcatcgttttggttttagtctttgtaaaaaaaaaatgttgtttttggtccctgcaaaatattt |
29686776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 313
Target Start/End: Complemental strand, 40979710 - 40979623
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||| |||||||||||| |||| |||||||||||||| |||||| |
|
|
| T |
40979710 |
ggctaaaatatggttttaatccctgcaaatatggctcgttttggttttaatccctgtaaaaaaaaaa--ttgtttttggtcccagcaaaa |
40979623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 50196657 - 50196564
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||| ||||||||||||||||||| |||| |||||||| ||||||||||| |||| |
|
|
| T |
50196657 |
ggctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtccctgtaaaaa-aaaaaaatgtttttgatccctgcaaaaaattt |
50196564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 51550446 - 51550352
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
51550446 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaatttttttgttgtttttggtccctgcaaaatattt |
51550352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 52342195 - 52342288
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||| || || |||||| ||| | ||||||||||| |||||||||||||| |
|
|
| T |
52342195 |
ggctaaaatatggttttggtccctgcaaatatgcctccttttggttttaatctctataaaaaaaaattgttgtttttggt-cctgcaaaatattt |
52342288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 226 - 318
Target Start/End: Complemental strand, 14772523 - 14772433
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||| | ||||||||| |||||||||||||||||||||||||||| |||| |||||||||||| ||| ||||||||| |
|
|
| T |
14772523 |
ctaaaatatggttttagtacatgcaaatatacctcattttggttttagtccctgtaaaa--aaaaagttgtttttggtcgctggaaaatattt |
14772433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 223 - 312
Target Start/End: Original strand, 15979337 - 15979426
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| || |||||||||||||||||| ||||| | | |||||||||||||||||||| |
|
|
| T |
15979337 |
tggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
15979426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 224 - 285
Target Start/End: Original strand, 30268505 - 30268566
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30268505 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaa |
30268566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 225 - 314
Target Start/End: Original strand, 46186410 - 46186499
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||| ||||||||| |||||||| |||| ||||||||||||| ||| |||| |
|
|
| T |
46186410 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccttgtaaaaaaaaaaaattgtttttggtccatgcgaaat |
46186499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 474408 - 474320
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||| |||| ||||| || | |||||||||||||||||||| |
|
|
| T |
474408 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaaaaaaatttgttgtttttggtccctgcaaa |
474320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 4814898 - 4814812
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||| ||||||||||||||||| |||||| ||| |||||||||||||||||||||| |
|
|
| T |
4814898 |
ggctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtccctataaaaaaaaa---ttgtttttggtccctgcaaaat |
4814812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 227 - 314
Target Start/End: Original strand, 9863050 - 9863134
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||| |||||| |||| ||||||||| |||||||||||| |
|
|
| T |
9863050 |
taaaatatggttttagtccctgcaa-tatgcctcgttttggttttagtccctataaaaaaaaaa--ttgtttttgatccctgcaaaat |
9863134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 12740907 - 12740995
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| ||||| | | |||||||||||||||||||| |
|
|
| T |
12740907 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
12740995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 307
Target Start/End: Original strand, 21553889 - 21553973
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt-ttgtttttggtccct |
307 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||| ||||||| ||||||||||| ||| || ||||||||||||||| |
|
|
| T |
21553889 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagcccctgtaaaaaaaaatttgttgtttttggtccct |
21553973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 28552383 - 28552295
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
28552383 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaattttttgttgtttttggtccctgcaaa |
28552295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 29446206 - 29446119
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||| |||||||| ||| |||||| ||||||||||||||| |
|
|
| T |
29446206 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccttgtaaaaaaaaa---ttgtttctggtccctgcaaaat |
29446119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 226 - 314
Target Start/End: Original strand, 31869596 - 31869683
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||| | |||||||||||| ||| |||||||||||||||||||||||| |||| |||| ||||||||||| |||||| |
|
|
| T |
31869596 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtccctgtaaaaa-aaaaatttgattttggtccctacaaaat |
31869683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 45002021 - 45002109
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||| |||| ||||| || | ||||||||||||||| |||| |
|
|
| T |
45002021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgcaaaaaaaatttgttgtttttggtccctacaaa |
45002109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 47336228 - 47336316
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| || |||||||||||||||||| ||||| | | |||||||||||||||||||| |
|
|
| T |
47336228 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaaaaaattttgttgtttttggtccctgcaaa |
47336316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 54608518 - 54608606
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
54608518 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaattttttgttgtttttggtccctgcaaa |
54608606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 230 - 313
Target Start/End: Complemental strand, 8510523 - 8510440
Alignment:
| Q |
230 |
aatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||||||||||| |||| |||| ||||||||||||||| |||||| |
|
|
| T |
8510523 |
aatatggttttagtccctgcaaatatgtttcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtcccagcaaaa |
8510440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 14633889 - 14633798
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| || ||||||||||||||||| || |||| |||| |||||||||||||||||||||| |
|
|
| T |
14633889 |
ggctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccctggttaaaaaaaaaaattgtttttggtccctgcaaaat |
14633798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 30128284 - 30128376
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||| ||| ||||||||||||| ||||||||| ||| | ||||||||||||||||| |||||||| |
|
|
| T |
30128284 |
ggctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctgtaaaa--aaattgttgtttttggtccctgctaaatattt |
30128376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 1721452 - 1721358
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| || ||||||||||||||||||||||| | |||| ||||||||||||||||||||| |
|
|
| T |
1721452 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaaaatttttgtgttgtatttggtccctgcaaaatattt |
1721358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 25615975 - 25616033
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25615975 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
25616033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 25710510 - 25710599
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||| ||||| |||||||||||||||||| |||| |||| | ||||| |||||||||| |
|
|
| T |
25710510 |
ggctcaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaaaaa-aaaaatttgatattggttcctgcaaaat |
25710599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 28942525 - 28942614
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| || |||| |||| ||||||||||||||||||||||| |
|
|
| T |
28942525 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtttttggtaaaa-aaaaatttgtttttggtccctgcaaaat |
28942614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 305
Target Start/End: Complemental strand, 30130504 - 30130425
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtcc |
305 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||||||||||| ||| |||| |||| ||||||||||||| |
|
|
| T |
30130504 |
ggctcaaatatggttttagtcactgcaaatatgcctcattttggttttagtccatgtgaaaaaaaaa--ttgtttttggtcc |
30130425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 222 - 312
Target Start/End: Original strand, 43441268 - 43441358
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||| |||| ||||| | | |||||||||||||||||||| |
|
|
| T |
43441268 |
ttggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaaaaaattttgttgtttttggtccctgcaaa |
43441358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 222 - 312
Target Start/End: Original strand, 45005884 - 45005974
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||| ||| ||||| |||||||||||| ||||| ||| | |||||||||||||||||||| |
|
|
| T |
45005884 |
ttggttaaaatatggttttgatccctgcaaatatgtctcgttttgattttagtccctgcaaaaaaaaattgttgtttttggtccctgcaaa |
45005974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 53701663 - 53701605
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
53701663 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
53701605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 223 - 314
Target Start/End: Complemental strand, 275834 - 275746
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||| || ||||||||||||| || ||||||| |||| ||||||||||||||||||||| |
|
|
| T |
275834 |
tggctaaaatatgattttagtccctgtaaatatgcttcgttttggttttagttccagtaaaaaaaaaa---tgtttttggtccctgcaaaat |
275746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 227 - 312
Target Start/End: Complemental strand, 863649 - 863564
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||| |||||||||||||||||| || | |||||||||||||||||||| |
|
|
| T |
863649 |
taaaatatggttttggtccctgcaaatatgtttcgttttgattttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaa |
863564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 227 - 312
Target Start/End: Original strand, 3387268 - 3387353
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
3387268 |
taaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgaaaaaaaaatttgttgtttttggtccctgcaaa |
3387353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 18175791 - 18175876
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
18175791 |
ggctaaaatatggttttagtccctgcaaatatgtctc--gttggttttaatccctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
18175876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 22008892 - 22008835
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22008892 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22008835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 224 - 285
Target Start/End: Complemental strand, 48924240 - 48924179
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48924240 |
ggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgtaaaaa |
48924179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 224 - 313
Target Start/End: Original strand, 51500398 - 51500487
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
||||||||||||||| ||||| ||| ||||||||||| |||||||||||||| || |||||| |||| |||||||||||||||||||| |
|
|
| T |
51500398 |
ggctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagtctctataaaaaaaaaaaaatgtttttggtccctgcaaaa |
51500487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 225 - 285
Target Start/End: Original strand, 11463233 - 11463293
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11463233 |
gctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtccctgtaaaaa |
11463293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 224 - 312
Target Start/End: Complemental strand, 28452376 - 28452288
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||| || |||||||||||||||||| ||||| || | |||||||| ||||||||||| |
|
|
| T |
28452376 |
ggctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtccctgcaaaaaaaatttgttgtttttagtccctgcaaa |
28452288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 224 - 308
Target Start/End: Complemental strand, 30034472 - 30034388
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctg |
308 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||| |||||||||||||||||||||||| || | |||||||||||||||| |
|
|
| T |
30034472 |
ggctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctg |
30034388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 225 - 313
Target Start/End: Complemental strand, 36673244 - 36673157
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| || |||||||||||||| || ||||||| || | ||||||||||||||||||||| |
|
|
| T |
36673244 |
gctaaaatatggttttggtccctgcaaatatgacttattttggttttagttcccgtaaaaa-aatttgttgtttttggtccctgcaaaa |
36673157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 226 - 318
Target Start/End: Original strand, 46724545 - 46724637
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||| |||| ||| ||||||||| ||| |||| ||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
46724545 |
ctaaaatatgattttgatccttgcaaatatatctcgttttagttttagtccctgtaaaaaaaaattattgtttttggtccctgcaaaatattt |
46724637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 318
Target Start/End: Complemental strand, 45313864 - 45313769
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| || ||||| ||||||||||||||| | ||| |||||||||||||||||||||||| |
|
|
| T |
45313864 |
tggctaaaatatggttttggtccctgcaaatatgcttcgttttgattttagtccctgtaattttagtttttagtttttggtccctgcaaaatattt |
45313769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 290
Target Start/End: Complemental strand, 50261937 - 50261870
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaa |
290 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||||||||| |||| |
|
|
| T |
50261937 |
tggctaaaatatcgttttagtccctgcaaatatgtttcattttggttttagtctctgtaaaaaaaaaa |
50261870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 474044 - 474138
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |||| | ||||||||||||||||||||||||| |
|
|
| T |
474044 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaatttttttggtgtttttggtccctgcaaaatattt |
474138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 227 - 285
Target Start/End: Complemental strand, 8940522 - 8940464
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
8940522 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaaaa |
8940464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 225 - 301
Target Start/End: Original strand, 9596759 - 9596832
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttg |
301 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||| || |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9596759 |
gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtccctgtaaa---aaaattttgtttttg |
9596832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 308
Target Start/End: Original strand, 29525105 - 29525185
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctg |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||| |||||||| |||||||||| ||| |||||||||||||||| |
|
|
| T |
29525105 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagt-cctgtaaaaaaaaa---ttgtttttggtccctg |
29525185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 30106220 - 30106162
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
30106220 |
ggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgtaa |
30106162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 309
Target Start/End: Original strand, 30424628 - 30424711
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgc |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||| ||||||||| ||||||||| |||| |||||||||||| |||| |
|
|
| T |
30424628 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagtctctgtaaaaaaaaaa--ttgtttttggtcactgc |
30424711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 35407790 - 35407697
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| |||||||||||||| || |||| ||||||||||||||||||| || | ||||||||| |||||||||||||||| |
|
|
| T |
35407790 |
ggctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagtccctgtaaaaa-aatttgttgtttttgatccctgcaaaatattt |
35407697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 227 - 308
Target Start/End: Original strand, 36732643 - 36732722
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctg |
308 |
Q |
| |
|
||||||| |||||| ||||||||||||||| || |||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
36732643 |
taaaataaggttttggtccctgcaaatatgtcttattttggttttagtttctgtaaaa--aaaattttgtttttggtccctg |
36732722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 226 - 314
Target Start/End: Complemental strand, 43440785 - 43440700
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||||| | | ||||||| |||||||||||||||||||||| |
|
|
| T |
43440785 |
ctaaaatataattttagtccctgcaaatatgcctcgttttggttttagtccat---ataagaaaaaattgtttttggtccctgcaaaat |
43440700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 47005519 - 47005425
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||| ||||||||||||||| |||||| | |||||||||||||||||||||||||| |
|
|
| T |
47005519 |
ggctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtccttgtaaattttttttgttgtttttggtccctgcaaaatattt |
47005425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 47902147 - 47902058
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||| | ||||||||||||||||||| |||| |||| ||||||||||||||| ||||| |
|
|
| T |
47902147 |
ttggctaaaatatagttttagtccccgcaaatatgcattgttttggttttagtccctgttaaaaaaaaa---tgtttttggtccctgtaaaat |
47902058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 226 - 314
Target Start/End: Complemental strand, 7518444 - 7518358
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||| ||||||||||||| | |||||||| |||| |||||||| |||||||||||| |
|
|
| T |
7518444 |
ctaaaatatggttttactccctgcaaatatgtctcgttttggttttagttcttgtaaaaaaaaaa--atgtttttgatccctgcaaaat |
7518358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 20404890 - 20404986
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaa--ttttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| | ||||||||||| |||| || |||||||||| ||||||||| |||| | |||||||||||||||||||||||||| |
|
|
| T |
20404890 |
ggctaaaatatggttttgcttcctgcaaatatacctcgttatggttttagtttctgtaaaaaaaaaaattgttgtttttggtccctgcaaaatattt |
20404986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 31480502 - 31480445
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31480502 |
ttggctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtccctg |
31480445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 224 - 292
Target Start/End: Original strand, 39288573 - 39288642
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaatt |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||| || ||||||| |||||| |
|
|
| T |
39288573 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctggtaaaaaaaaaatt |
39288642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 226 - 318
Target Start/End: Original strand, 2486581 - 2486673
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||||| | ||||| | ||||||||||||||| |||||||||||| |
|
|
| T |
2486581 |
ctaaaatatggtttttgtccctgcaaatatgactcattttggttttagttcatgtaattttatttttttgtttttggtccttgcaaaatattt |
2486673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 222 - 282
Target Start/End: Complemental strand, 4035055 - 4034995
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||| |||||||| ||||||| |
|
|
| T |
4035055 |
ttggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagttcctgtaa |
4034995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 222 - 282
Target Start/End: Complemental strand, 7957228 - 7957168
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
7957228 |
ttggctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtccctgtaa |
7957168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 222 - 282
Target Start/End: Original strand, 20644503 - 20644563
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
20644503 |
ttggctaaaatatagttttggtccctgcaaatatgtctcattttgattttagtccctgtaa |
20644563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 43440495 - 43440581
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||| |||| |||||||||||| |||||| ||| ||||||||||| |||||||||| |
|
|
| T |
43440495 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctataaaaaaaaa---ttgtttttggt-cctgcaaaat |
43440581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 222 - 318
Target Start/End: Original strand, 52956381 - 52956477
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||| |||| |||||| | |||||| ||| ||||||||||||| | |||||||| || | |||||||||||||||||||||||||| |
|
|
| T |
52956381 |
ttggctaaaatatacttttggtccctactaatatgtctcgttttggttttagttcatgtaaaaaaaatgtgttgtttttggtccctgcaaaatattt |
52956477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 227 - 282
Target Start/End: Original strand, 1721092 - 1721147
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1721092 |
taaaatatggttttggtccttgcaaatatgtctcattttggttttagtccctgtaa |
1721147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 227 - 290
Target Start/End: Complemental strand, 12673978 - 12673915
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaa |
290 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
12673978 |
taaaatatgattttagttcctgcaaatatgcctcattttggttttagtttctgtaaaaaaaaaa |
12673915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 227 - 282
Target Start/End: Complemental strand, 40545836 - 40545781
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40545836 |
taaaatatgattttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
40545781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 222 - 292
Target Start/End: Complemental strand, 49670805 - 49670734
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccc-tgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt |
292 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| || |||||||||||||||||| |||| |||||| |
|
|
| T |
49670805 |
ttggctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccctggtaaaaaaaaatt |
49670734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 3387604 - 3387546
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
3387604 |
ggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccatgtaa |
3387546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 14772211 - 14772269
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| || |||||||||||||||| |||| |
|
|
| T |
14772211 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcccggtaa |
14772269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 227 - 314
Target Start/End: Original strand, 20807800 - 20807882
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||| ||||||| |||||||||| || ||||||||||||||| |||||| |
|
|
| T |
20807800 |
taaaatatggttttagtccctgcaaatatacgtcattttgattttagt-cctgtaaaaaaaa----ttgtttttggtccctacaaaat |
20807882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 225 - 283
Target Start/End: Complemental strand, 25610129 - 25610071
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||| ||||||||| |||||| |
|
|
| T |
25610129 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccttgtaaa |
25610071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 29490743 - 29490685
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||| |||||| |
|
|
| T |
29490743 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaa |
29490685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 35565508 - 35565566
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
35565508 |
ggctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtccctgtaa |
35565566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 40545564 - 40545622
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||| |||||||||||||||| |
|
|
| T |
40545564 |
ggctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgtaa |
40545622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 47005154 - 47005212
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||| |||||||||||||||| |
|
|
| T |
47005154 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctgtaa |
47005212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 224 - 285
Target Start/End: Original strand, 7588318 - 7588379
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
7588318 |
ggctaaaatatagttttggtccctgcaaatatgccttgttttggttttagtctctgtaaaaa |
7588379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 49 - 130
Target Start/End: Original strand, 13533144 - 13533225
Alignment:
| Q |
49 |
cttgaacaaagcatttttcaactccaaagaaccccatctattaaagctctttttactaatagcttcatcatttgcaagccac |
130 |
Q |
| |
|
||||||||| |||||||| || ||||||| |||| |||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
13533144 |
cttgaacaaggcattttttaatgccaaagaccccctactattaaagctctttttaatgttagcttcatcatttgcaagccac |
13533225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 224 - 285
Target Start/End: Original strand, 15286156 - 15286217
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || |||||||||||||| |||||||| |
|
|
| T |
15286156 |
ggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtctttgtaaaaa |
15286217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 224 - 276
Target Start/End: Complemental strand, 34238915 - 34238863
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtcc |
276 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| || ||||||||||||||| |
|
|
| T |
34238915 |
ggctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagtcc |
34238863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 227 - 314
Target Start/End: Original strand, 49670477 - 49670562
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||| ||||||||| |||||||||| || ||||||||||| |||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
49670477 |
taaaatatgattttagtccttgcaaatatggcttgttttggttttaatccctggtaaaaaaaaa--ttgtttttggtccctgcaaaat |
49670562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 225 - 273
Target Start/End: Complemental strand, 51760117 - 51760069
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttag |
273 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
51760117 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag |
51760069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 234 - 308
Target Start/End: Complemental strand, 16123491 - 16123420
Alignment:
| Q |
234 |
tggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctg |
308 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||| | |||||||| |||| |||||||||||||||| |
|
|
| T |
16123491 |
tggttttagtcc-tgcaaatatgcctcgttttggttttagttcttgtaaaaaaaaaa--ttgtttttggtccctg |
16123420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 227 - 314
Target Start/End: Original strand, 27200441 - 27200527
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||| |||||||| | || |||| |||| ||||||||||||||||| ||||| |
|
|
| T |
27200441 |
taaaatatggttttaatccctgcaaatatatctcattttagttttagttcttgataaaataaaa-tttgtttttggtccctgtaaaat |
27200527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 29678024 - 29678116
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||| ||||| ||| |||||||||||||| ||||||||||||||||||| || |||||||||||||||| |||||||||||| |
|
|
| T |
29678024 |
ggctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtccctgt--aatttttattttgtttttggtccttgcaaaatattt |
29678116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 224 - 279
Target Start/End: Complemental strand, 30552478 - 30552423
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| ||| |||||||||||||||||| |
|
|
| T |
30552478 |
ggctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtccctg |
30552423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 20644876 - 20644782
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||| |||||| || | ||||| ||||||||||||||||| | ||||||||| |||||||||||||||| |
|
|
| T |
20644876 |
ggctaaaatatggttttggtccctgtaaatataccccgttttgattttagtccctgtaaaatttttgtgttgtttttgatccctgcaaaatattt |
20644782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 27681682 - 27681624
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||| | ||| ||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
27681682 |
ggctaaaatatggttctggtctctgcaaatatgcctcgttttggttttaatccctgtaa |
27681624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 223 - 277
Target Start/End: Complemental strand, 30426227 - 30426174
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccc |
277 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
30426227 |
tggctaaaatatggttttagtcc-tgcaaatatgcctcgttttgattttagtccc |
30426174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 32119220 - 32119314
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| ||| |||| ||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
32119220 |
ggctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtccctgcaaattttttttgttgtttttggtccctgcaaaatattt |
32119314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 39132906 - 39132848
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||| ||||||| ||||||||||| |
|
|
| T |
39132906 |
ggctaaaatatggttttggtccctgcaaatatgtttcatattggtttaagtccctgtaa |
39132848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 40277822 - 40277880
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||| || ||||||||||| ||||||||| |
|
|
| T |
40277822 |
ggctaaaatgtggttttggtccctgcaaatatgcttcgttttggttttactccctgtaa |
40277880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 227 - 293
Target Start/End: Complemental strand, 45521833 - 45521767
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattt |
293 |
Q |
| |
|
|||||||||||||||||| |||||||||| || ||||||||||||| |||||||||| ||||||| |
|
|
| T |
45521833 |
taaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctgtaaaaaaaaaattt |
45521767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 227 - 305
Target Start/End: Original strand, 47901803 - 47901879
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtcc |
305 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| || |||||||||||||||| ||||||| ||| |||||||| |||||| |
|
|
| T |
47901803 |
taaaatatggttttagtctctggaaatatgcatcgttttggttttagtccc-gtaaaaa-aaacttttgtttctggtcc |
47901879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 285
Target Start/End: Complemental strand, 20757775 - 20757714
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||| ||||| |||||| |||||||| || |||||||||||||| ||||||||| |
|
|
| T |
20757775 |
ggctaaaatatgattttaatccctgtaaatatgcatcgttttggttttagtctctgtaaaaa |
20757714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 285
Target Start/End: Original strand, 35498416 - 35498477
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||| |||||||||| |||||||| || ||||||||||| |||||||||||| |
|
|
| T |
35498416 |
ggctaaaatatgggtttagtccctacaaatatgattcgttttggttttaatccctgtaaaaa |
35498477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 285
Target Start/End: Original strand, 46901104 - 46901165
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || ||||||||||||| ||||||||| |
|
|
| T |
46901104 |
ggctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagtttctgtaaaaa |
46901165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 226 - 282
Target Start/End: Complemental strand, 2486900 - 2486844
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||| |||||||||||||||| || ||||||||||| ||| ||||| |
|
|
| T |
2486900 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccttgtaa |
2486844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 227 - 283
Target Start/End: Complemental strand, 4322186 - 4322130
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||| ||||| ||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
4322186 |
taaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgtaaa |
4322130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 227 - 279
Target Start/End: Complemental strand, 49324143 - 49324091
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
49324143 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
49324091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 227 - 282
Target Start/End: Complemental strand, 8555305 - 8555250
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| || ||||||||||||||| ||||| |
|
|
| T |
8555305 |
taaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccttgtaa |
8555250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 227 - 282
Target Start/End: Original strand, 10778373 - 10778428
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||| ||||||| ||||||| |
|
|
| T |
10778373 |
taaaatatggttttagtttctgcaaatatgcctcgttttgattttagttcctgtaa |
10778428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 226 - 285
Target Start/End: Original strand, 16679678 - 16679737
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||||||||||| || |||||||| || |||||||||||||| |||||||| |
|
|
| T |
16679678 |
ctaaaatatggttttagtccttgaaaatatgcttcgttttggttttagtctttgtaaaaa |
16679737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 224 - 283
Target Start/End: Complemental strand, 20405223 - 20405164
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
||||||||||||||||| |||||||||||||| | | |||| ||||||||||||||||| |
|
|
| T |
20405223 |
ggctaaaatatggttttggtccctgcaaatatactttgttttagttttagtccctgtaaa |
20405164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 224 - 279
Target Start/End: Complemental strand, 46622129 - 46622074
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| || |||||||||||||||||| |
|
|
| T |
46622129 |
ggctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtccctg |
46622074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 224 - 275
Target Start/End: Original strand, 47114487 - 47114538
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
275 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
47114487 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
47114538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 3387338 - 3387380
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3387338 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
3387380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 4034790 - 4034832
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4034790 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
4034832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 4321946 - 4322004
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||| | ||| |||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
4321946 |
ggctaaaatatggttctgatccttgcaaatatgtctcattttggttttaatccctgtaa |
4322004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 9262081 - 9262039
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9262081 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
9262039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 249 - 314
Target Start/End: Complemental strand, 10778706 - 10778643
Alignment:
| Q |
249 |
caaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||| |||| ||||| |||||||||||||||| |
|
|
| T |
10778706 |
caaatatgcctcgttttggttttagtccctggtaaaaaaaaa--ttgttattggtccctgcaaaat |
10778643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 266
Target Start/End: Original strand, 25353199 - 25353241
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttg |
266 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25353199 |
ggctagaatatggttttagtccctgcaaatatgcctcgttttg |
25353241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 29686544 - 29686602
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||| ||||||||||| |||| |||||||||| || ||||||||||||||||||||| |
|
|
| T |
29686544 |
ggctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtccctgtaa |
29686602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 274
Target Start/End: Original strand, 35177255 - 35177305
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
274 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
35177255 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
35177305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 275
Target Start/End: Original strand, 35565581 - 35565619
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtc |
275 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35565581 |
ttttggtccctgcaaatatgcctcattttggttttagtc |
35565619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 45005959 - 45006001
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45005959 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
45006001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 50009284 - 50009226
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||| ||||||||| |||| |||||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
50009284 |
ggctaaactatggttttggtccttgcaaatatgcctcgttttgattttaatccctgtaa |
50009226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #216
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 227 - 285
Target Start/End: Original strand, 51058593 - 51058651
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||||||||| |||| ||||||| || ||||| ||||||||||||||||| |
|
|
| T |
51058593 |
taaaatatggttttagtctctgctaatatgcatcgttttgactttagtccctgtaaaaa |
51058651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #217
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 52342509 - 52342467
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
52342509 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
52342467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #218
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 52956627 - 52956585
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
52956627 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
52956585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #219
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 227 - 285
Target Start/End: Complemental strand, 54767524 - 54767466
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||||| |||||| ||||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
54767524 |
taaaatatggttttggtccctagaaatatgtctcgttttgattttagtccctgtaaaaa |
54767466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #220
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 225 - 282
Target Start/End: Complemental strand, 11463480 - 11463423
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||| ||| ||||||| ||||||| |||||||||||||| |||||| |
|
|
| T |
11463480 |
gctaaaatatggtttcggtcgctgcaaaaatgcctcgttttggttttagtctctgtaa |
11463423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #221
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 224 - 281
Target Start/End: Complemental strand, 13514577 - 13514520
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta |
281 |
Q |
| |
|
|||||||||||| |||| || |||||||||||| ||| ||||||||||||||| |||| |
|
|
| T |
13514577 |
ggctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagtccatgta |
13514520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #222
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 225 - 282
Target Start/End: Complemental strand, 28418899 - 28418842
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| | ||||| ||||||||||||||| |
|
|
| T |
28418899 |
gctaaaatatggttttggtccctgcaaatatgttttgttttgattttagtccctgtaa |
28418842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #223
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 237 - 278
Target Start/End: Complemental strand, 28452303 - 28452262
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccct |
278 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
28452303 |
ttttagtccctgcaaatatgtctcattttggttttggtccct |
28452262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #224
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 29678390 - 29678333
Alignment:
| Q |
221 |
gttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct |
278 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||| |||||||||||| |||| |
|
|
| T |
29678390 |
gttggctaaaatatgattttggtccctgcaaatatgccctgttttggttttagcccct |
29678333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #225
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 227 - 314
Target Start/End: Original strand, 30552150 - 30552233
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||| || |||||||||| || ||||||||||||||||| ||||| ||| ||||||||| |||||||||||| |
|
|
| T |
30552150 |
taaaatatggttttagacc-tgcaaatatgtcttgttttggttttagtccctcaaaaaaaaaa---ttgtttttgatccctgcaaaat |
30552233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #226
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 237 - 278
Target Start/End: Complemental strand, 40370515 - 40370474
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccct |
278 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40370515 |
ttttggtccctgcaaatatgcctcattttggttttggtccct |
40370474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #227
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 265 - 314
Target Start/End: Original strand, 45320661 - 45320709
Alignment:
| Q |
265 |
tggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
45320661 |
tggttttagtccctgtaaaaa-aaaaaattgtttttggtccctgcaaaat |
45320709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #228
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 225 - 278
Target Start/End: Original strand, 50008921 - 50008974
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct |
278 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||| | |||||||||||||||||| |
|
|
| T |
50008921 |
gctagaatatggttttggtccctgcaaatatgttttattttggttttagtccct |
50008974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #229
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 253 - 285
Target Start/End: Original strand, 8555016 - 8555048
Alignment:
| Q |
253 |
tatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
8555016 |
tatgcctcattttggttttagtccctgtaaaaa |
8555048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #230
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 245 - 308
Target Start/End: Original strand, 20907158 - 20907222
Alignment:
| Q |
245 |
cctgcaaatatgcctcattttggttttagtccctgt-aaaaagaaaattttgtttttggtccctg |
308 |
Q |
| |
|
|||| ||||||| ||| ||||||||||||||||||| ||||| |||| |||||||||| |||||| |
|
|
| T |
20907158 |
cctgtaaatatgtctcgttttggttttagtccctgtaaaaaataaaaatttgtttttgatccctg |
20907222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #231
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 224 - 260
Target Start/End: Complemental strand, 26273824 - 26273788
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctc |
260 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26273824 |
ggctaaaatatggttttagtcccagcaaatatgcctc |
26273788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #232
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 224 - 256
Target Start/End: Complemental strand, 26800169 - 26800137
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatg |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26800169 |
ggctaaaatatggttttagtccctgcaaatatg |
26800137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #233
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 227 - 283
Target Start/End: Complemental strand, 35177563 - 35177507
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| || ||||||||||| |||||||||| |
|
|
| T |
35177563 |
taaaatatggttttcatccttgcaaatatgcttccttttggttttaatccctgtaaa |
35177507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #234
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 227 - 275
Target Start/End: Original strand, 40723121 - 40723169
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
275 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||| ||||||||||||| |
|
|
| T |
40723121 |
taaaatatggttttagtccttgcaaatattcctcgatttggttttagtc |
40723169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #235
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 240 - 312
Target Start/End: Original strand, 46962596 - 46962668
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| || ||||| |||| ||||||||||| |
|
|
| T |
46962596 |
tagtccctgcaaatatctgatattttggttttagtccctgtaaaaaaaattttttggttttagtccctgcaaa |
46962668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #236
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 224 - 300
Target Start/End: Original strand, 53121302 - 53121378
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgttttt |
300 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| | ||| |||||||||||||| |||| |||||||||||||| |
|
|
| T |
53121302 |
ggctaaaatatgtttttggtccctgcaaatatagcgagtttgggttttagtccctggtaaaaaaaaattttgttttt |
53121378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #237
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 237 - 280
Target Start/End: Complemental strand, 9597022 - 9596979
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctgt |
280 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
9597022 |
ttttggtccctgcaaatacgcctcattttggttttggtccctgt |
9596979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #238
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 237 - 276
Target Start/End: Complemental strand, 11463408 - 11463369
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtcc |
276 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
11463408 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
11463369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #239
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 224 - 283
Target Start/End: Complemental strand, 16679962 - 16679903
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||| |||| ||| |||||||||||| || ||||||||| ||||| |||||||||| |
|
|
| T |
16679962 |
ggctaaaagatggctttggtccctgcaaatttgtctcattttgattttaatccctgtaaa |
16679903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #240
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 242 - 285
Target Start/End: Complemental strand, 33794788 - 33794745
Alignment:
| Q |
242 |
gtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
33794788 |
gtccctgcaaatatgcctcgttttaattttagtccctgtaaaaa |
33794745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #241
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 227 - 282
Target Start/End: Original strand, 36672966 - 36673021
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| || |||||||||||||| |||||| |
|
|
| T |
36672966 |
taaaatatggttttggtctctgcaaatatgtcttgttttggttttagtctctgtaa |
36673021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #242
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 242 - 285
Target Start/End: Original strand, 40560492 - 40560535
Alignment:
| Q |
242 |
gtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
40560492 |
gtccctgcaaatatgcctcgttttaattttagtccctgtaaaaa |
40560535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #243
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 224 - 255
Target Start/End: Original strand, 44506582 - 44506613
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatat |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44506582 |
ggctaaaatatggttttagtccctgcaaatat |
44506613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #244
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 226 - 313
Target Start/End: Original strand, 46621778 - 46621865
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
||||||||| ||||| |||| |||||||||||||||||| |||||| | | |||||| || |||| |||||||||||||||||| |
|
|
| T |
46621778 |
ctaaaatattgttttgatcccagcaaatatgcctcattttagttttattttcggtaaaataaattttttatttttggtccctgcaaaa |
46621865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #245
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 224 - 271
Target Start/End: Original strand, 53113443 - 53113490
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggtttt |
271 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||| |||| |
|
|
| T |
53113443 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttgttttt |
53113490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #246
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 474335 - 474293
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
474335 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
474293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #247
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 863579 - 863537
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
863579 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
863537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #248
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 225 - 283
Target Start/End: Original strand, 7956870 - 7956928
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaa |
283 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| |||||||||||||| | |||||||| |
|
|
| T |
7956870 |
gctaaaatatggttttggtctttgtaaatatgcttcattttggttttaattcctgtaaa |
7956928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #249
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 12740980 - 12741022
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
12740980 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
12741022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #250
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 242 - 312
Target Start/End: Complemental strand, 14784078 - 14784009
Alignment:
| Q |
242 |
gtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||| | | ||| ||||| ||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
14784078 |
gtccctgcaaatatgacccgtttaagttttcgtccctgtaaaaataaaa-attgtttttggtccctgcaaa |
14784009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #251
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 15979411 - 15979453
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
15979411 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
15979453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #252
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 19844339 - 19844381
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
19844339 |
ttttggtccctgtaaatatgcctcattttggttttggtccctg |
19844381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #253
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 22008817 - 22008775
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
22008817 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
22008775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #254
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 22016335 - 22016293
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
22016335 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
22016293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #255
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 28552310 - 28552268
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
28552310 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
28552268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #256
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 232 - 282
Target Start/End: Original strand, 29490377 - 29490427
Alignment:
| Q |
232 |
tatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||| |||||| ||||||||| | ||||||||||||||||||||| |
|
|
| T |
29490377 |
tatggttttggtccctacaaatatgcaccgttttggttttagtccctgtaa |
29490427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #257
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 31480427 - 31480385
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
31480427 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
31480385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #258
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 32119511 - 32119469
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
32119511 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
32119469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #259
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 224 - 282
Target Start/End: Original strand, 35936780 - 35936838
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| | || ||||||||||| |||| |||| |
|
|
| T |
35936780 |
ggctaaaatatggttttggtccctacaaatatacttcgttttggttttaatccccgtaa |
35936838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #260
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Complemental strand, 49324073 - 49324031
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
49324073 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
49324031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #261
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 54608591 - 54608633
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
54608591 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
54608633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #262
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 253
Target Start/End: Complemental strand, 10792970 - 10792941
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaat |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10792970 |
ggctaaaatatggttttagtccctgcaaat |
10792941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #263
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 234 - 279
Target Start/End: Complemental strand, 25610061 - 25610016
Alignment:
| Q |
234 |
tggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||| ||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
25610061 |
tggttttggtccctgcaaatatgtctcgttttggttttggtccctg |
25610016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #264
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 248 - 312
Target Start/End: Complemental strand, 36732945 - 36732883
Alignment:
| Q |
248 |
gcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||| || ||||||||||| ||||||||||| ||||| ||||||||| | |||||||| |
|
|
| T |
36732945 |
gcaaatatgcttcgttttggttttaatccctgtaaaa--aaaatattgtttttgatacctgcaaa |
36732883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #265
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 39071862 - 39071948
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||| ||||||||| | ||||||||| || |||| |||||||| || |||||| || |||||||||||||||||||||| |
|
|
| T |
39071862 |
ggctaaaatatatttttagtccttacaaatatgcttcgttttagttttagtgtctataaaaaaaa----ttgtttttggtccctgcaaaat |
39071948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #266
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 226 - 255
Target Start/End: Original strand, 39819314 - 39819343
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatat |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39819314 |
ctaaaatatggttttagtccctgcaaatat |
39819343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #267
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 222 - 255
Target Start/End: Original strand, 43641141 - 43641174
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatat |
255 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
43641141 |
ttggctaaaatatgcttttagtccctgcaaatat |
43641174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #268
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 278
Target Start/End: Original strand, 47336301 - 47336342
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccct |
278 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
47336301 |
ttttggtccctgcaaatatgtctcattttggttttggtccct |
47336342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #269
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 285
Target Start/End: Complemental strand, 52835914 - 52835870
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
52835914 |
tagtccctgcaaatatccgtcattttggttttagt-cctgtaaaaa |
52835870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #270
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 284
Target Start/End: Complemental strand, 21971046 - 21970990
Alignment:
| Q |
228 |
aaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
|||||||||||||| || || |||||||||||| ||||| ||||||| |||||||| |
|
|
| T |
21971046 |
aaaatatggttttaatctctacaaatatgcctcgttttgattttagtttctgtaaaa |
21970990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #271
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 284
Target Start/End: Complemental strand, 21993482 - 21993426
Alignment:
| Q |
228 |
aaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
|||||||||||||| || || |||||||||||| ||||| ||||||| |||||||| |
|
|
| T |
21993482 |
aaaatatggttttaatctctacaaatatgcctcgttttgattttagtttctgtaaaa |
21993426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #272
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 223 - 255
Target Start/End: Original strand, 27681325 - 27681357
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatat |
255 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
27681325 |
tggctaaaatatggttttggtccctgcaaatat |
27681357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #273
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 226 - 282
Target Start/End: Original strand, 35533281 - 35533337
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||| ||| ||||||||||| || |||||||||||| || ||||| |
|
|
| T |
35533281 |
ctaaaatatggttttggtctctgcaaatatgtcttgttttggttttagaccttgtaa |
35533337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #274
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 230 - 282
Target Start/End: Complemental strand, 38232594 - 38232542
Alignment:
| Q |
230 |
aatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||| || |||||||||||| ||| ||||||||| |||| |||||| |
|
|
| T |
38232594 |
aatatggttttggtacctgcaaatatgtctcgttttggtttcagtctctgtaa |
38232542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 5209 - 5303
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||||| ||||| |||| |
|
|
| T |
5209 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaaaaataaaattttgtttttggtccctccaaaaaattt |
5303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 5229 - 5323
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||||| ||||| |||| |
|
|
| T |
5229 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaaaaataaaattttgtttttggtccctccaaaaaattt |
5323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 75; Significance: 2e-34; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 9028 - 8938
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| ||||||||||||||||| |||||| |
|
|
| T |
9028 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaacttttgtttttggtccctacaaaat |
8938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 226 - 290
Target Start/End: Original strand, 8734 - 8798
Alignment:
| Q |
226 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaa |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaaa |
8798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 75; Significance: 2e-34; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 12182 - 12272
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12182 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaaaataaaaattttgtttttggtccctgcaaaat |
12272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 223 - 312
Target Start/End: Complemental strand, 12537 - 12448
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||||||| |||||||| |||| |||||||||||||| |||||| |
|
|
| T |
12537 |
tggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccttgtaaaaaaaaaaatttgtttttggtccatgcaaa |
12448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 72; Significance: 9e-33; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 15012 - 14924
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
15012 |
ggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
14924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 219 - 314
Target Start/End: Original strand, 14692 - 14785
Alignment:
| Q |
219 |
atgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |||| || |||||||||||| ||||| |
|
|
| T |
14692 |
atgtaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtgaaaaaaaaaatt--gttttggtccctgtaaaat |
14785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 71; Significance: 4e-32; HSPs: 2)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 24372 - 24462
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||| ||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
24372 |
ggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgttaaaagaaaaatttgtttttggtccctgcaaaat |
24462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 24657 - 24570
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||| ||||||||| | |||||||||||| ||||| |||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
24657 |
ggctaaaatataattttagtcc-tacaaatatgcctcgttttgattttagtccctgtaaaaaataaa--ttgtttttggtccctgcaaaat |
24570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 70; Significance: 1e-31; HSPs: 3)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 224 - 317
Target Start/End: Original strand, 54815 - 54908
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatatt |
317 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| || | ||||||||||||||||||||||||| |
|
|
| T |
54815 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccctgcaaaatatt |
54908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 227 - 284
Target Start/End: Complemental strand, 50075 - 50018
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaa |
50018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 227 - 284
Target Start/End: Complemental strand, 55176 - 55119
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaaa |
55119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 69; Significance: 6e-31; HSPs: 2)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 2778 - 2865
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
2778 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaaa---ttgtttttggtccctgcaaaat |
2865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 265 - 314
Target Start/End: Complemental strand, 3098 - 3049
Alignment:
| Q |
265 |
tggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
3098 |
tggttttagtccctgtcaaaaaaaaaatttgtttttggtccctgcaaaat |
3049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 67; Significance: 9e-30; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 8547 - 8637
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
8547 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaatttgtttttggtccctgcaaaat |
8637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 67; Significance: 9e-30; HSPs: 3)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 82706 - 82612
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| || | ||||||||||||| |||||||||||| |
|
|
| T |
82706 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaatttgttgtttttggtccttgcaaaatattt |
82612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 82341 - 82429
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| ||||||||||||| | ||| |||||||||||||||||| ||||| || | |||||||||||||||||||| |
|
|
| T |
82341 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctgcaaaaaaaatttgttgtttttggtccctgcaaa |
82429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 82414 - 82456
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
82414 |
ttttggtccctgcaaatatgccttattttggttttggtccctg |
82456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 67; Significance: 9e-30; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 224 - 318
Target Start/End: Original strand, 75359 - 75453
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| |||||||||||||||||||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
75359 |
ggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaaattgttgtttttggtccctgcaaaatattt |
75453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 224 - 279
Target Start/End: Complemental strand, 75764 - 75709
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
75764 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
75709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 66; Significance: 4e-29; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 366273 - 366187
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
366273 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaaaaaaaa----ttgtttttggtccctgcaaaat |
366187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 224 - 285
Target Start/End: Original strand, 365979 - 366040
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
365979 |
ggctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctgtaaaaa |
366040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 64; Significance: 6e-28; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 223 - 314
Target Start/End: Original strand, 12524 - 12614
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |||||||| |||| |||||||||||||||||||||| |
|
|
| T |
12524 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaaaaa-aaaaaattgtttttggtccctgcaaaat |
12614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 64; Significance: 6e-28; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 5708 - 5617
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
5708 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctggtaaaaaaaaaaatttgtttttggtccctgcaaaat |
5617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 224 - 313
Target Start/End: Original strand, 5399 - 5487
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaa |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| ||| |||| |||| ||||||||||||| |||||||| |
|
|
| T |
5399 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtctctggtaaaa-aaaaatttgtttttggtctctgcaaaa |
5487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 1311 - 1401
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
1311 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaat |
1401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 1644 - 1554
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
1644 |
ggctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccctggtaaaaaaaaaaattgtttttggtccctgcaaaat |
1554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 62; Significance: 9e-27; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 222 - 314
Target Start/End: Complemental strand, 4314 - 4224
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||||| |||| ||||||||| ||||||||||||| |
|
|
| T |
4314 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttgagtccttgtaaaa--aaaaatttgtttttcgtccctgcaaaat |
4224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 231 - 284
Target Start/End: Original strand, 4016 - 4069
Alignment:
| Q |
231 |
atatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaa |
284 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||||| |||| |
|
|
| T |
4016 |
atatggttttagtccctacaaatatgcctcgttttggttttagtccctgcaaaa |
4069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 289 - 200
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
289 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 3291 - 3203
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||||| |||| |||||||||||| |||||||||| |
|
|
| T |
3291 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaaaa--aaaaatttgtttttggtacctgcaaaat |
3203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 223 - 314
Target Start/End: Original strand, 34930 - 35021
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| ||| || |||||||||||||||||||||||| |
|
|
| T |
34930 |
tggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctggtaaattaattttttgtttttggtccctgcaaaat |
35021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 223 - 312
Target Start/End: Original strand, 3531 - 3617
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
3531 |
tggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaaaaaaaaa---ttgtttttggtccctgcaaa |
3617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 3918 - 3860
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
3918 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaa |
3860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 60; Significance: 1e-25; HSPs: 3)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 215 - 318
Target Start/End: Complemental strand, 148291 - 148188
Alignment:
| Q |
215 |
ttttatgttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||| ||| ||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| || | || ||||||||||| ||||||| |
|
|
| T |
148291 |
ttttctgtgggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaaaaaatttgttttttttggtcccagcaaaat |
148192 |
T |
|
| Q |
315 |
attt |
318 |
Q |
| |
|
|||| |
|
|
| T |
148191 |
attt |
148188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 147890 - 147975
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| |||| |||||||||||| ||||| || | |||||||||||||| ||||| |
|
|
| T |
147890 |
ggctaaaatatggtttt-gtccctgcaaatat--ctcgttttagttttagtccctacaaaaaaaatttgttgtttttggtcccagcaaa |
147975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 147960 - 148002
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
147960 |
ttttggtcccagcaaatatgcctcattttggttttggtccctg |
148002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 59; Significance: 5e-25; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 224 - 314
Target Start/End: Original strand, 8330 - 8420
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||| ||||||||| |||||||| |||| ||||||||||||| |||||||| |
|
|
| T |
8330 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaaaaaaaaaaaattgtttttggtccttgcaaaat |
8420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 8642 - 8584
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||| ||||||||| ||||| |
|
|
| T |
8642 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaa |
8584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 18043 - 17952
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgta-aaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||| ||||||||||||| |||| ||||| |||||||| |||||| |||||| |
|
|
| T |
18043 |
ggctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctgtaaaaaaaaaaatattgtttttcgtccctacaaaat |
17952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 54; Significance: 5e-22; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 224 - 311
Target Start/End: Original strand, 4041 - 4127
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaa |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||| | ||||||| |||| ||||||||||||||||||| |
|
|
| T |
4041 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggtaaaaaaaaaa--ttgtttttggtccctgcaa |
4127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 224 - 311
Target Start/End: Original strand, 19223 - 19309
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaa |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||| | ||||||| |||| ||||||||||||||||||| |
|
|
| T |
19223 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttggtaaaaaaaaaa--ttgtttttggtccctgcaa |
19309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 4288 - 4199
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||||||| | ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
4288 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
4199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 19470 - 19381
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct-gtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||||||| | ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
19470 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccttggtaaaaaaaaaa--ttgtttttggtccctgcaaaat |
19381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 224 - 317
Target Start/End: Complemental strand, 2660 - 2565
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaat--tttgtttttggtccctgcaaaatatt |
317 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |||||| | | | |||||||||| ||||||||||||||| |
|
|
| T |
2660 |
ggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccctataaaaaaatatttgtttgtttttgatccctgcaaaatatt |
2565 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 272
Target Start/End: Original strand, 2334 - 2382
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
272 |
Q |
| |
|
||||| ||||||||||| |||||||||||||| ||| ||||||||||| |
|
|
| T |
2334 |
ggctataatatggttttggtccctgcaaatattccttgttttggtttta |
2382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 52; Significance: 8e-21; HSPs: 2)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 222 - 285
Target Start/End: Complemental strand, 17968 - 17905
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||| |
|
|
| T |
17968 |
ttggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgtaaaaa |
17905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 225 - 285
Target Start/End: Original strand, 17651 - 17711
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||| || |||| ||||||||||||||||||| |
|
|
| T |
17651 |
gctaaaatatgattttaatccctacaaatatgtcttgttttagttttagtccctgtaaaaa |
17711 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 27364 - 27270
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||||| | ||||||||| |||||||||||||||| |
|
|
| T |
27364 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaaaatttttttgttgtttttgatccctgcaaaatattt |
27270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 27072 - 27114
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
27072 |
ttttggtccctgcaaatatgcctcgttttggttttggtccctg |
27114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 224 - 314
Target Start/End: Complemental strand, 10515 - 10429
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||||| ||| |||||||||||| |||||||| |
|
|
| T |
10515 |
ggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgtaaaaaaaaa----tgtttttggtccttgcaaaat |
10429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 224 - 276
Target Start/End: Original strand, 10168 - 10220
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtcc |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10168 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
10220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 49; Significance: 5e-19; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 224 - 312
Target Start/End: Original strand, 94057 - 94145
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
94057 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatccctgtaaatttttgtttttgtttttggtccctgcaaa |
94145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 225 - 272
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
| Q |
225 |
gctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
272 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
94329 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 48; Significance: 2e-18; HSPs: 3)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 227 - 282
Target Start/End: Complemental strand, 48228 - 48173
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtctctgtaa |
48173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 224 - 279
Target Start/End: Original strand, 47925 - 47980
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
47925 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
47980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 224 - 276
Target Start/End: Complemental strand, 223172 - 223120
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtcc |
276 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
223172 |
ggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
223120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0578 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: scaffold0578
Description:
Target: scaffold0578; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 227 - 316
Target Start/End: Complemental strand, 5067 - 4977
Alignment:
| Q |
227 |
taaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaatt-ttgtttttggtccctgcaaaatat |
316 |
Q |
| |
|
|||||||||||||| ||| |||||||||| ||| ||||||||||||| ||||||||| ||| || |||||||||||||||||||||||| |
|
|
| T |
5067 |
taaaatatggttttggtctctgcaaatatatctcgttttggttttagtttctgtaaaaaaaaatttgttgtttttggtccctgcaaaatat |
4977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0472 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0472
Description:
Target: scaffold0472; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 7264 - 7171
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||| || ||||||||||| | ||||||||| |||| ||||||||||||||||| ||||||||| |
|
|
| T |
7264 |
ggctaaaatatgattttggtctctgcaaatatgtcttgttttggttttaatttctgtaaaaa-aaaaatttgtttttggtccctgtaaaatattt |
7171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0860 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: scaffold0860
Description:
Target: scaffold0860; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 49 - 130
Target Start/End: Original strand, 2673 - 2754
Alignment:
| Q |
49 |
cttgaacaaagcatttttcaactccaaagaaccccatctattaaagctctttttactaatagcttcatcatttgcaagccac |
130 |
Q |
| |
|
||||||||| |||||||| || ||||||| |||| |||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
2673 |
cttgaacaaggcattttttaatgccaaagaccccctactattaaagctctttttaatgttagcttcatcatttgcaagccac |
2754 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 224 - 285
Target Start/End: Original strand, 3752 - 3813
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaa |
285 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| | ||||||||||| |||||||||||| |
|
|
| T |
3752 |
ggctaaaatatggttttggtccctgcaaatatgctttgttttggttttaatccctgtaaaaa |
3813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 318
Target Start/End: Complemental strand, 4079 - 3985
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaaatattt |
318 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||| ||| |||| ||||||||| || | |||| | |||||||||||||||||||||||||| |
|
|
| T |
4079 |
ggctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagtctctatgaaaattttttgttgtttttggtccctgcaaaatattt |
3985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 222 - 282
Target Start/End: Original strand, 16722 - 16782
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
16722 |
ttggctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtccctgtaa |
16782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 22055 - 21997
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| |||||| ||||| |||||| ||||||||||||||| ||||| |
|
|
| T |
22055 |
ggctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagtccttgtaa |
21997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 2)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 189678 - 189620
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||| ||||| ||| ||||||||||||||||||||||||||| || |||||| |
|
|
| T |
189678 |
ggctaaaatatagtttttgtcgctgcaaatatgcctcattttggttttaatctctgtaa |
189620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 237 - 279
Target Start/End: Original strand, 189401 - 189443
Alignment:
| Q |
237 |
ttttagtccctgcaaatatgcctcattttggttttagtccctg |
279 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||| ||||||| |
|
|
| T |
189401 |
ttttagttcctgcaaatatgactcattttggttttggtccctg |
189443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 222 - 274
Target Start/End: Complemental strand, 3457 - 3405
Alignment:
| Q |
222 |
ttggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
274 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||| ||| ||||||||||||| |
|
|
| T |
3457 |
ttggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
3405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 224 - 272
Target Start/End: Complemental strand, 44206 - 44158
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggtttta |
272 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||| |||||||||||||| |
|
|
| T |
44206 |
ggctaaaatatggctttggtccctgcaaatatgcttcattttggtttta |
44158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 2884 - 2829
Alignment:
| Q |
223 |
tggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct |
278 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||| |||||||||| |
|
|
| T |
2884 |
tggctaaaatatggttttggtccctgcaaatatgtctcgttttgagtttagtccct |
2829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 2501 - 2555
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccct |
278 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || ||||| ||||||||||| |
|
|
| T |
2501 |
ggctaaaatatggttttgatccctgcaaatatgcttcgttttgattttagtccct |
2555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 282
Target Start/End: Complemental strand, 35084 - 35026
Alignment:
| Q |
224 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
282 |
Q |
| |
|
||||||||||||||||| ||| | |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
35084 |
ggctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtccctgtaa |
35026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0817 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0817
Description:
Target: scaffold0817; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 240 - 312
Target Start/End: Complemental strand, 4351 - 4279
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| | ||||| |||| ||||||||||| |
|
|
| T |
4351 |
tagtccctgcaaatatctgacattttggttttagtccctgtaaaaatatttttttggttttagtccctgcaaa |
4279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0103 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0103
Description:
Target: scaffold0103; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 240 - 312
Target Start/End: Original strand, 43291 - 43363
Alignment:
| Q |
240 |
tagtccctgcaaatatgcctcattttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| | | |||| |||| ||||||||||| |
|
|
| T |
43291 |
tagtccctgcaaatatttgacattttggttttagtccctgtaaaaatatattttttgttttagtccctgcaaa |
43363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0147 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 262 - 312
Target Start/End: Complemental strand, 25458 - 25408
Alignment:
| Q |
262 |
ttttggttttagtccctgtaaaaagaaaattttgtttttggtccctgcaaa |
312 |
Q |
| |
|
|||||||||||||||||||||||| || ||||| |||| ||||||||||| |
|
|
| T |
25458 |
ttttggttttagtccctgtaaaaataattttttggttttagtccctgcaaa |
25408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University