View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19136_low_5 (Length: 343)
Name: NF19136_low_5
Description: NF19136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19136_low_5 |
 | |
|
| [»] chr6 (177 HSPs) |
| |
|
| [»] chr1 (262 HSPs) |
| |
|
| [»] chr7 (232 HSPs) |
| |
|
| [»] scaffold0210 (2 HSPs) |
| | |
|
| [»] scaffold0160 (3 HSPs) |
| | |
|
| [»] scaffold0001 (3 HSPs) |
| | |
|
| [»] scaffold0005 (5 HSPs) |
| | |
|
| [»] scaffold0370 (1 HSPs) |
| | |
|
| [»] scaffold0026 (3 HSPs) |
| | |
|
| [»] scaffold0024 (3 HSPs) |
| | |
|
| [»] scaffold1001 (1 HSPs) |
| | |
|
| [»] scaffold0811 (2 HSPs) |
| | |
|
| [»] scaffold0119 (2 HSPs) |
| |
|
| [»] scaffold0003 (2 HSPs) |
| | |
|
| [»] scaffold0060 (2 HSPs) |
| |
|
| [»] scaffold0056 (5 HSPs) |
| | |
|
| [»] scaffold0179 (1 HSPs) |
| | |
|
| [»] scaffold0535 (2 HSPs) |
| | |
|
| [»] scaffold0337 (1 HSPs) |
| | |
|
| [»] scaffold0085 (2 HSPs) |
| |
|
| [»] scaffold0065 (2 HSPs) |
| | |
|
| [»] scaffold0051 (2 HSPs) |
| | |
|
| [»] scaffold0326 (4 HSPs) |
| | |
|
| [»] scaffold0166 (1 HSPs) |
| | |
|
| [»] scaffold0007 (2 HSPs) |
| |
|
| [»] scaffold0712 (1 HSPs) |
| | |
|
| [»] scaffold0709 (1 HSPs) |
| | |
|
| [»] scaffold0176 (3 HSPs) |
| |
|
| [»] scaffold0684 (2 HSPs) |
| | |
|
| [»] scaffold0016 (2 HSPs) |
| | |
|
| [»] scaffold0373 (1 HSPs) |
| | |
|
| [»] scaffold0021 (2 HSPs) |
| | |
|
| [»] scaffold0078 (3 HSPs) |
| | |
|
| [»] scaffold0159 (1 HSPs) |
| | |
|
| [»] scaffold0123 (1 HSPs) |
| | |
|
| [»] scaffold0002 (4 HSPs) |
| | |
|
| [»] scaffold0347 (2 HSPs) |
| | |
|
| [»] scaffold0105 (2 HSPs) |
| | |
|
| [»] scaffold0011 (2 HSPs) |
| | |
|
| [»] scaffold0578 (1 HSPs) |
| | |
|
| [»] scaffold0008 (1 HSPs) |
| | |
|
| [»] scaffold0472 (2 HSPs) |
| | |
|
| [»] scaffold0204 (1 HSPs) |
| |
|
| [»] scaffold0339 (1 HSPs) |
| | |
|
| [»] scaffold0106 (1 HSPs) |
| | |
|
| [»] scaffold0517 (1 HSPs) |
| | |
|
| [»] scaffold0817 (1 HSPs) |
| | |
|
| [»] scaffold0103 (1 HSPs) |
| | |
|
| [»] scaffold0045 (1 HSPs) |
| | |
|
| [»] scaffold0009 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 6e-62; HSPs: 222)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 129 - 281
Target Start/End: Original strand, 6412579 - 6412731
Alignment:
| Q |
129 |
gatcaatttgcaaacaaactcatatcattcaaattaattaatagtataaaatgttaaaatacatacaaatgatatgacaaaatttaagtgatcagagtat |
228 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6412579 |
gatcaatttgcaaacaaacgcatatcattcaaattaattaatagcataaaatgttaaaatacatacaaatgatatgacaaaatttaagtgatcagagtat |
6412678 |
T |
|
| Q |
229 |
tcatgtcttcatatcattagcttagacaatcaactcattgattaaatttataa |
281 |
Q |
| |
|
|||||||||||||||| | ||| ||| |||| |||||||||||||||||||| |
|
|
| T |
6412679 |
tcatgtcttcatatcaacaactttgacgatcatctcattgattaaatttataa |
6412731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 281 - 343
Target Start/End: Original strand, 17073806 - 17073868
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17073806 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
17073868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 17574464 - 17574402
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17574464 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
17574402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 282 - 343
Target Start/End: Complemental strand, 42430120 - 42430059
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42430120 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccttgtaattt |
42430059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 8298977 - 8298917
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8298977 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
8298917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 282 - 341
Target Start/End: Complemental strand, 7186004 - 7185945
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaat |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7186004 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaat |
7185945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 10337118 - 10337177
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10337118 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
10337177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 24815069 - 24815010
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24815069 |
aggctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtccctgtaa |
24815010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 8298587 - 8298645
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8298587 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
8298645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 279 - 337
Target Start/End: Original strand, 11019517 - 11019575
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11019517 |
taaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11019575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 14489073 - 14489015
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14489073 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
14489015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 42133154 - 42133096
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42133154 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
42133096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 7420228 - 7420285
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7420228 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
7420285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 32725905 - 32725962
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32725905 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
32725962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 3512267 - 3512211
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3512267 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3512211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 11976371 - 11976431
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
11976371 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
11976431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 20984144 - 20984204
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
20984144 |
aaggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgtaa |
20984204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 20984512 - 20984452
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
20984512 |
aaggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaa |
20984452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 35097327 - 35097383
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35097327 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35097383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 35346999 - 35346943
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35346999 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 1778564 - 1778619
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1778564 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1778619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 285 - 340
Target Start/End: Original strand, 13232201 - 13232256
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
13232256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 280 - 343
Target Start/End: Original strand, 20277690 - 20277753
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||| ||||||||||||||||||| |
|
|
| T |
20277690 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgtaattt |
20277753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 280 - 343
Target Start/End: Original strand, 21064317 - 21064380
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||| ||||||||||||||||||| |
|
|
| T |
21064317 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgtaattt |
21064380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 25600229 - 25600288
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
25600229 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgtaa |
25600288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 29158353 - 29158412
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29158353 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
29158412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 278 - 337
Target Start/End: Original strand, 34963296 - 34963355
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
34963296 |
ataaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
34963355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 34963664 - 34963609
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34963664 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
34963609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 35346629 - 35346684
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35346629 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35346684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 7326421 - 7326363
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
7326421 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
7326363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 278 - 340
Target Start/End: Complemental strand, 10540786 - 10540724
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
10540786 |
ataaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaa |
10540724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 280 - 338
Target Start/End: Original strand, 14238749 - 14238807
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14238749 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
14238807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 278 - 340
Target Start/End: Original strand, 16789071 - 16789133
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
16789071 |
ataaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaa |
16789133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 279 - 337
Target Start/End: Original strand, 28346391 - 28346449
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
28346391 |
taaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 281 - 343
Target Start/End: Original strand, 40492959 - 40493021
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40492959 |
aggctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctgtaattt |
40493021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 2728230 - 2728287
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2728230 |
aaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg |
2728287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 4474047 - 4473986
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
4474047 |
taaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgtaa |
4473986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 7420593 - 7420532
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
7420593 |
taaggctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctgtaa |
7420532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 28324184 - 28324123
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
28324184 |
taaggctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtccctgtaa |
28324123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 37536084 - 37536141
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
37536084 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
37536141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 4473703 - 4473759
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
4473703 |
aggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
4473759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 4710221 - 4710165
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
4710221 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4710165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 7272418 - 7272478
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
7272418 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgtaa |
7272478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 9175010 - 9175070
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9175010 |
aaggctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctgtaa |
9175070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 9496340 - 9496396
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
9496340 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
9496396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 10872913 - 10872973
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
10872913 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgtaa |
10872973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 11019858 - 11019802
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
11019858 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
11019802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 285 - 337
Target Start/End: Complemental strand, 11976733 - 11976681
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11976733 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
11976681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 284 - 340
Target Start/End: Complemental strand, 18549571 - 18549515
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18549571 |
ctaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccctgtaa |
18549515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 22650462 - 22650522
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
22650462 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
22650522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 25131109 - 25131169
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
25131109 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaa |
25131169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 25600599 - 25600539
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25600599 |
aaggctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgtaa |
25600539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 336
Target Start/End: Complemental strand, 27117978 - 27117922
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
27117978 |
aaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttggtccct |
27117922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 27341593 - 27341533
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
27341593 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
27341533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 28346759 - 28346703
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
28346759 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28346703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 32726272 - 32726216
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
32726272 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
32726216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 43477161 - 43477221
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
43477161 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
43477221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 2728597 - 2728542
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
2728597 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2728542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 285 - 340
Target Start/End: Complemental strand, 13796593 - 13796538
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13796593 |
taaaatatggtttggatccctgcaaatatgtctcattttggttttagtccctgtaa |
13796538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 279 - 338
Target Start/End: Complemental strand, 14239083 - 14239024
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
14239083 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
14239024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 278 - 337
Target Start/End: Original strand, 22917560 - 22917619
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
22917560 |
ataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22917619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 27117752 - 27117811
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
27117752 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgtaa |
27117811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 35097692 - 35097637
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
35097692 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35097637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 42132864 - 42132919
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
42132864 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctg |
42132919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 280 - 343
Target Start/End: Original strand, 42429756 - 42429818
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
42429756 |
aaggctaaaatatggttttggtccctacaaatatgcctca-tttggttttagtccctgtaattt |
42429818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 4621354 - 4621296
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
4621354 |
ggctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
4621296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 279 - 337
Target Start/End: Complemental strand, 9496726 - 9496668
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
9496726 |
taaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
9496668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 332
Target Start/End: Complemental strand, 13232562 - 13232512
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13232562 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
13232512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 279 - 337
Target Start/End: Complemental strand, 16644047 - 16643989
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
16644047 |
taaggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctg |
16643989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 16789369 - 16789311
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
16789369 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
16789311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 20278058 - 20277996
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||| ||||||||||||||| |||||||| |
|
|
| T |
20278058 |
aggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtccttgtaattt |
20277996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 21064685 - 21064623
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||| ||||||||||||||| |||||||| |
|
|
| T |
21064685 |
aggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtccttgtaattt |
21064623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 279 - 336
Target Start/End: Complemental strand, 1408356 - 1408299
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
1408356 |
taaggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccct |
1408299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 283 - 340
Target Start/End: Complemental strand, 24090487 - 24090430
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
| T |
24090487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtctctgtaa |
24090430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 24187899 - 24187842
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24187899 |
aaggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccctg |
24187842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 271 - 340
Target Start/End: Complemental strand, 29488121 - 29488052
Alignment:
| Q |
271 |
taaatttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||| | ||||||||||||||||||| ||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
29488121 |
taaattcaaaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaa |
29488052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 1526173 - 1526117
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
1526173 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg |
1526117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 279 - 343
Target Start/End: Complemental strand, 2811784 - 2811720
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||| |||||||||||||| || |||||| |
|
|
| T |
2811784 |
taaggttaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtctctttaattt |
2811720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 3511905 - 3511961
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
3511905 |
aggctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtccctg |
3511961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 287 - 343
Target Start/End: Original strand, 3680532 - 3680588
Alignment:
| Q |
287 |
aaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||| |||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
3680532 |
aaatatggttttgctccctgcaaatatgactcgttttggttttagtccctgtaattt |
3680588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 7326085 - 7326141
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||| |||||||||||||||||| |
|
|
| T |
7326085 |
aggctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtccctg |
7326141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 8094478 - 8094534
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
8094478 |
aggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctg |
8094534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 10337450 - 10337394
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||| ||||||||||||| |
|
|
| T |
10337450 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
10337394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 13779151 - 13779207
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
13779151 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttattccctgtaa |
13779207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 283 - 343
Target Start/End: Complemental strand, 13779531 - 13779471
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||| |||||||||||| ||||||||||| |
|
|
| T |
13779531 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagcccctgtaattt |
13779471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 14495067 - 14495127
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
14495067 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
14495127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 19494118 - 19494174
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
19494118 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
19494174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 19494414 - 19494358
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
19494414 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19494358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 32418316 - 32418376
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
32418316 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
32418376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 283 - 343
Target Start/End: Complemental strand, 36044791 - 36044731
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||||||||| || ||||||||| |
|
|
| T |
36044791 |
gctaaaatatggttttggtccctgcaaatgtgtctcgttttggttttaatctctgtaattt |
36044731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 40844537 - 40844477
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
40844537 |
aaggttaaaatatggttttagtccctgcaaatatatctcgttttggttttagtccctgtaa |
40844477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 336
Target Start/End: Original strand, 5357422 - 5357477
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
5357422 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccct |
5357477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 276 - 343
Target Start/End: Complemental strand, 6469673 - 6469606
Alignment:
| Q |
276 |
ttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||| ||||||||||||| |||||||| |||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
6469673 |
ttattaggctaaaatatgattttggtcactgcaaatatgttacgttttggttttagtccctgtaattt |
6469606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 284 - 343
Target Start/End: Original strand, 10776150 - 10776209
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||||| ||| |||||||| |
|
|
| T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccttgtaattt |
10776209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 10873280 - 10873225
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||| |||||||||||||||||| |
|
|
| T |
10873280 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
10873225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 13155252 - 13155193
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
13155252 |
aggctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatccctgtaa |
13155193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 280 - 343
Target Start/End: Original strand, 14847823 - 14847886
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||| ||||||||| ||||| |||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
14847823 |
aaggttaaaatatgattttgatccctgcaaatatgcctcattttggttttagtccctataattt |
14847886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 287 - 334
Target Start/End: Original strand, 24814710 - 24814757
Alignment:
| Q |
287 |
aaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24814710 |
aaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
24814757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 336
Target Start/End: Complemental strand, 24955011 - 24954956
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
24955011 |
aggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccct |
24954956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 280 - 343
Target Start/End: Original strand, 28497253 - 28497316
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||| |||| |||||||||| |||||||| |
|
|
| T |
28497253 |
aaggctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagtccatgtaattt |
28497316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 285 - 340
Target Start/End: Complemental strand, 28497616 - 28497561
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
28497616 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
28497561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 37536419 - 37536364
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
37536419 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
37536364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 4375692 - 4375750
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
4375692 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaa |
4375750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 7272751 - 7272693
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| | ||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
7272751 |
ggctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctgtaa |
7272693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 10776499 - 10776441
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
10776499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
10776441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 281 - 343
Target Start/End: Original strand, 13154885 - 13154947
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||| |||||| ||| |||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
13154885 |
aggctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagtccctgtaattt |
13154947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 15719656 - 15719714
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||| |||||||||||||||| |||| |
|
|
| T |
15719656 |
ggctaaaatatggttttagtccctgcaaatatatctcgttttggttttagtcccggtaa |
15719714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 281 - 323
Target Start/End: Complemental strand, 25702810 - 25702768
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcatttt |
323 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25702810 |
aggctaaaatatggttttggtccctgcaaatatgtctcatttt |
25702768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 279 - 337
Target Start/End: Original strand, 38930299 - 38930357
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||| ||||||||||||| |||| |
|
|
| T |
38930299 |
taaggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcctg |
38930357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 40066820 - 40066762
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
40066820 |
ggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtccctgtaa |
40066762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 40844156 - 40844214
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
40844156 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
40844214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 280 - 333
Target Start/End: Original strand, 1525807 - 1525860
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
1525807 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
1525860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 4017302 - 4017245
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||| |||||||||||||||||| |
|
|
| T |
4017302 |
aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
4017245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 283 - 340
Target Start/End: Complemental strand, 6146948 - 6146891
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
6146948 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaa |
6146891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 15930933 - 15930990
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||| ||||||| ||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
15930933 |
gctaaaatatgattttggttcctacaaatatgtctcgttttggttttagtccctgtaa |
15930990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 282 - 343
Target Start/End: Original strand, 23939547 - 23939608
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |||| |||||||| ||| |||||| |
|
|
| T |
23939547 |
ggctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagttcctataattt |
23939608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 279 - 340
Target Start/End: Original strand, 24187566 - 24187627
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
24187566 |
taaggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtccctgtaa |
24187627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 30969399 - 30969456
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| || ||||||||||||||||||||| |
|
|
| T |
30969399 |
gctaaaatatggttttggtccttacaaatatgtttcgttttggttttagtccctgtaa |
30969456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 282 - 343
Target Start/End: Original strand, 32195280 - 32195341
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |||||||| || |||||| |
|
|
| T |
32195280 |
ggctaaaatatggttttggtccctacaaatatgtctcattttaattttagtctctataattt |
32195341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 281 - 338
Target Start/End: Complemental strand, 33526413 - 33526356
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
33526413 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgt |
33526356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 340
Target Start/End: Original strand, 6469274 - 6469338
Alignment:
| Q |
276 |
ttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| |||||||||||||| ||| ||||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
6469274 |
ttattaggctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcctgtaa |
6469338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 276 - 336
Target Start/End: Original strand, 14496810 - 14496870
Alignment:
| Q |
276 |
ttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||| || ||||||||||||||||| |
|
|
| T |
14496810 |
ttataaggctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagtccct |
14496870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 16643660 - 16643716
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || |||||||||||||||||| |
|
|
| T |
16643660 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
16643716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 272 - 328
Target Start/End: Complemental strand, 30337227 - 30337171
Alignment:
| Q |
272 |
aaatttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttt |
328 |
Q |
| |
|
|||||| |||||||||||||| ||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
30337227 |
aaatttttaaggctaaaatatagttttagtccctgcaaatatgtctcgttttggttt |
30337171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 40066495 - 40066555
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||| |||||||| ||||||| |
|
|
| T |
40066495 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcctgtaa |
40066555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 278 - 337
Target Start/End: Original strand, 4016901 - 4016960
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||| ||| ||||||||||| |||||| |
|
|
| T |
4016901 |
ataaagctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
4016960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 285 - 340
Target Start/End: Complemental strand, 9175368 - 9175313
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||| |||||||||||||| |||||| |
|
|
| T |
9175368 |
taaaatatggttttggtccctgtaaatatgcctcgttttggttttagtctctgtaa |
9175313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 336
Target Start/End: Original strand, 10540448 - 10540503
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||| ||| ||||||||||||||||| |
|
|
| T |
10540448 |
aggctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagtccct |
10540503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 18549200 - 18549259
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || |||||||||||||| |||||| |
|
|
| T |
18549200 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtctctgtaa |
18549259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 19962994 - 19963053
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| || |||| |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
19962994 |
aggctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtccctgtaa |
19963053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 280 - 339
Target Start/End: Original strand, 21125717 - 21125776
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
339 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| ||| ||||||||||| |||||||| |
|
|
| T |
21125717 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgta |
21125776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 25702511 - 25702570
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||| |||| ||||||||||||||| |
|
|
| T |
25702511 |
aggctaaaatatggttttggtccctgtaaatatgcctcgttttaattttagtccctgtaa |
25702570 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 28399036 - 28398977
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
28399036 |
aggctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtccctgtaa |
28398977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 29992301 - 29992242
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
29992301 |
aggctcaaatatggttttgttccctgcaaatatgcctcgttttgattttagtccctgtaa |
29992242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 32040074 - 32040133
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| | || |||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
32040074 |
aggctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtccctgtaa |
32040133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 35345618 - 35345559
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
35345618 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttaatccctgtaa |
35345559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 280 - 334
Target Start/End: Original strand, 1685112 - 1685166
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
1685112 |
aaggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
1685166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 294 - 340
Target Start/End: Complemental strand, 1778917 - 1778871
Alignment:
| Q |
294 |
gttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
1778917 |
gttttggtccctgcaaatatgtctcgttttggttttaatccctgtaa |
1778871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 2728524 - 2728482
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2728524 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
2728482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 3512193 - 3512151
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3512193 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
3512151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 4709979 - 4710021
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4709979 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
4710021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 7326159 - 7326201
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7326159 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
7326201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 281 - 335
Target Start/End: Complemental strand, 8094842 - 8094788
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccc |
335 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||| |||||||||||||||| |
|
|
| T |
8094842 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccc |
8094788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 9496650 - 9496608
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9496650 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
9496608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 11019593 - 11019635
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11019593 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
11019635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 11976663 - 11976621
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11976663 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
11976621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 20984219 - 20984261
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20984219 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
20984261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 336
Target Start/End: Complemental strand, 25131447 - 25131393
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||| ||||||||||||||||| |
|
|
| T |
25131447 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccct |
25131393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 28346685 - 28346643
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28346685 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
28346643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 29158669 - 29158611
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||| ||||||||||||||| ||||| |
|
|
| T |
29158669 |
ggctaaaatatggttttaatccctgcaaatatatctcgttttggttttagtccttgtaa |
29158611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 281 - 335
Target Start/End: Original strand, 33636321 - 33636375
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccc |
335 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || |||||||||||||||| |
|
|
| T |
33636321 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccc |
33636375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 34963373 - 34963415
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
34963373 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
34963415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 35097619 - 35097577
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35097619 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
35097577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 37536346 - 37536304
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37536346 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
37536304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 279 - 337
Target Start/End: Complemental strand, 38930667 - 38930609
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||| ||||||||||| |||||| |
|
|
| T |
38930667 |
taaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttaatccctg |
38930609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 3680803 - 3680746
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
3680803 |
aaggctaaaatatgattttgatccctgcaaatatgcctcgttttggttttggtccctg |
3680746 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 6146517 - 6146574
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
6146517 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccttgtaa |
6146574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 279 - 336
Target Start/End: Original strand, 28323846 - 28323903
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||| || ||||||||||||||||| |
|
|
| T |
28323846 |
taaggctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtccct |
28323903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 280 - 333
Target Start/End: Complemental strand, 31445465 - 31445412
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
||||||||||||| |||||| ||||| |||||||| |||||||||||||||||| |
|
|
| T |
31445465 |
aaggctaaaatatagttttgatccctacaaatatgcctcattttggttttagtc |
31445412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 283 - 343
Target Start/End: Complemental strand, 5357762 - 5357702
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||| |||||||||||||||||||| || |||||||||||||| |||||||| |
|
|
| T |
5357762 |
gctaaaatatgattttggtccctgcaaatatgcttcgttttggttttagtctttgtaattt |
5357702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 28 - 68
Target Start/End: Original strand, 6412478 - 6412518
Alignment:
| Q |
28 |
gttttgttttttactaaaatatgataatcatccaatagagt |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6412478 |
gttttgttttttactaaaatatgataatcatgcaatagagt |
6412518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 9832213 - 9832273
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||| | ||||||||||| ||||||||| |
|
|
| T |
9832213 |
aaggctaaattatggttttggtccttgcaaatatgttttgttttggttttaatccctgtaa |
9832273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 14488714 - 14488774
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| ||||| ||||||| ||||||| ||| |||||||||||||| |||||| |
|
|
| T |
14488714 |
aaggctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagtctctgtaa |
14488774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 26530666 - 26530726
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||| |||||||| |||||||| ||||||| |
|
|
| T |
26530666 |
aaggcttaaatatggttttagtccatgcaaatatgcctcattttagttttagttcctgtaa |
26530726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 282 - 334
Target Start/End: Original strand, 29487750 - 29487802
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||| || ||||||||||||||| |
|
|
| T |
29487750 |
ggctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagtcc |
29487802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 29991913 - 29991973
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||| ||| |||| ||||||||| |||||| |
|
|
| T |
29991913 |
aaggttaaaatatggttttggtctctgcaaatatgcctcgttttagttttagtctctgtaa |
29991973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 284 - 340
Target Start/End: Complemental strand, 43727431 - 43727376
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
43727431 |
ctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtccttgtaa |
43727376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 44997929 - 44997989
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||| ||||| ||||| | ||||||| |
|
|
| T |
44997929 |
aaggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttaattcctgtaa |
44997989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 282 - 334
Target Start/End: Complemental strand, 44998263 - 44998211
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||||| || || |||||||||||| ||||||||||||||| |
|
|
| T |
44998263 |
ggctaaaatatggttttgatctctacaaatatgtctcgttttggttttagtcc |
44998211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 1162909 - 1162964
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || ||||| |||||||||||| |
|
|
| T |
1162909 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg |
1162964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 3031602 - 3031547
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| ||||||| |||||| ||||||| |
|
|
| T |
3031602 |
ggctaaaatatgtttttggtccctgtaaatatggctcatttaggttttggtccctg |
3031547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 21126022 - 21125963
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| ||||| |||| || ||||||| ||| ||||||||||||||||||||| |
|
|
| T |
21126022 |
aggctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtccctgtaa |
21125963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 280 - 343
Target Start/End: Complemental strand, 23939912 - 23939849
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||| ||||||||||||||| | |||||||||||| ||| |||||| |||||||| |||||||| |
|
|
| T |
23939912 |
aaggttaaaatatggttttgattcctgcaaatatgactcgttttggctttagtccatgtaattt |
23939849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 280 - 343
Target Start/End: Original strand, 24090117 - 24090180
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||| | || | ||||||||| ||||| ||||||||||| |||||| |
|
|
| T |
24090117 |
aaggctaaaatatggttttggttcttgtagatatgtctcgttttgattttagtccctataattt |
24090180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 1408005 - 1408063
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||| |||| ||||||| ||||||| |
|
|
| T |
1408005 |
ggctaaaatatggttttagtccatgcaaatatgtctcgttttagttttagctcctgtaa |
1408063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 8298660 - 8298702
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
8298660 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
8298702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #177
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 10337376 - 10337334
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
10337376 |
ttttggtccctgcaaatatgtctcattttagttttggtccctg |
10337334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #178
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 10540522 - 10540564
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
10540522 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
10540564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #179
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 282 - 336
Target Start/End: Complemental strand, 10755528 - 10755474
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||| ||||| ||||| |
|
|
| T |
10755528 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccct |
10755474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #180
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 23939620 - 23939662
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
23939620 |
ttttggtccctgcaaatatatctcgttttggttttagtccctg |
23939662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #181
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 329
Target Start/End: Complemental strand, 32726198 - 32726164
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32726198 |
ttttggtccctgcaaatatgtctcattttggtttt |
32726164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #182
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 35346702 - 35346744
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
35346702 |
ttttggtccctgcaaatatgtctcattttgattttggtccctg |
35346744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #183
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 44998191 - 44998149
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
44998191 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
44998149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #184
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 283 - 335
Target Start/End: Complemental strand, 14495389 - 14495337
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccc |
335 |
Q |
| |
|
||||||||||||| || ||||| ||||||||| ||| |||||||||||||||| |
|
|
| T |
14495389 |
gctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagtccc |
14495337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #185
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 281 - 334
Target Start/End: Complemental strand, 28258242 - 28258189
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||| ||||||||||||||| |
|
|
| T |
28258242 |
aggctaaaatatggttttaacctctgcaaatatgtctcgttttggttttagtcc |
28258189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #186
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 295 - 336
Target Start/End: Complemental strand, 28324109 - 28324068
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
28324109 |
ttttggtccctacaaatatgtctcattttggttttggtccct |
28324068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #187
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 279 - 343
Target Start/End: Original strand, 2355884 - 2355948
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||| | |||| ||||||||||||| || ||||||||||||||||| |||||| |
|
|
| T |
2355884 |
taaggctaaaatataggtttgatccctgcaaatataccttgttttggttttagtccctctaattt |
2355948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #188
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 285 - 341
Target Start/End: Complemental strand, 2356245 - 2356189
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaat |
341 |
Q |
| |
|
||||||||| ||||| | | |||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
2356245 |
taaaatatgattttgattcatgcaaatatgtctcgttttggttttagtctctgtaat |
2356189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #189
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 285 - 333
Target Start/End: Original strand, 17574105 - 17574153
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
17574105 |
taaaatatggttttggtccctgcaaatatgtcgggttttgattttagtc |
17574153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #190
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 282 - 314
Target Start/End: Complemental strand, 30969717 - 30969685
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatg |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30969717 |
ggctaaaatatggttttggtccctgcaaatatg |
30969685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #191
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 282 - 334
Target Start/End: Original strand, 33526052 - 33526104
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
33526052 |
ggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtcc |
33526104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #192
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 35115640 - 35115584
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| ||| |||||||||| ||||||| |
|
|
| T |
35115640 |
aggctaaaatatggttttagtccctacaaatatacctcgttttggttttggtccctg |
35115584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #193
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 35143845 - 35143789
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||| || ||||||| ||| |||||||||||||||||| |
|
|
| T |
35143845 |
aggctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtccctg |
35143789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #194
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 283 - 334
Target Start/End: Complemental strand, 7578527 - 7578476
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
||||||||| |||||| | |||||||||||| ||||||||||||||||||| |
|
|
| T |
7578527 |
gctaaaatacggttttaattcctgcaaatatgactcattttggttttagtcc |
7578476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #195
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 295 - 334
Target Start/End: Complemental strand, 9175298 - 9175259
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
9175298 |
ttttggtccctgcaaatatgtctcgttttggttttggtcc |
9175259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #196
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 295 - 334
Target Start/End: Complemental strand, 13779462 - 13779423
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
13779462 |
ttttggtccctgcaaatatgtctcgttttggttttggtcc |
13779423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #197
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 286 - 333
Target Start/End: Complemental strand, 17074164 - 17074117
Alignment:
| Q |
286 |
aaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
17074164 |
aaaatatggttttggtccctgcaaatatgtcgggttttgattttagtc |
17074117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #198
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 289 - 340
Target Start/End: Original strand, 23360378 - 23360429
Alignment:
| Q |
289 |
atatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||| ||||||||| ||||| |
|
|
| T |
23360378 |
atatggttttggtctctgcaaatatgtctcgttttaattttagtccatgtaa |
23360429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #199
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 295 - 338
Target Start/End: Original strand, 25600304 - 25600347
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| |||||||| |
|
|
| T |
25600304 |
ttttggtccctgcaaatatgccttattttggttttggtccctgt |
25600347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #200
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 1778637 - 1778679
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||| ||||||| |
|
|
| T |
1778637 |
ttttggtccttgcaaatatgcctcattttggttttggtccctg |
1778679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #201
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 7420303 - 7420345
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
7420303 |
ttttagtccctgcaaatatgcctcattttggttttggtccctg |
7420345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #202
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 13232271 - 13232313
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
13232271 |
ttttagtccctgcaaatatgcctcattttggttttggtccctg |
13232313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #203
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 280 - 314
Target Start/End: Original strand, 14197823 - 14197857
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatg |
314 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
14197823 |
aaggctaaaatatgtttttggtccctgcaaatatg |
14197857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #204
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 275 - 313
Target Start/End: Original strand, 36588215 - 36588253
Alignment:
| Q |
275 |
tttataaggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
36588215 |
tttaaaaggctaaaatatgcttttggtccctgcaaatat |
36588253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #205
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 280 - 314
Target Start/End: Original strand, 39439922 - 39439956
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatg |
314 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
39439922 |
aaggctaaaatatgattttggtccctgcaaatatg |
39439956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #206
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 42132937 - 42132979
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||| ||||||| |
|
|
| T |
42132937 |
ttttggtctctgcaaatatgcctcattttggttttggtccctg |
42132979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #207
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 314
Target Start/End: Complemental strand, 4376011 - 4375978
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatg |
314 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
4376011 |
aggctaaaatatggttttagtccctgcaaatatg |
4375978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #208
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 303 - 340
Target Start/End: Complemental strand, 14848169 - 14848132
Alignment:
| Q |
303 |
cctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
14848169 |
cctgcaaatatgtctcgttttggttttagtccccgtaa |
14848132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #209
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 336
Target Start/End: Original strand, 24090192 - 24090233
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||| |||||| |
|
|
| T |
24090192 |
ttttggttcctgcaaatatgtctcgttttggttttcgtccct |
24090233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #210
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 342
Target Start/End: Original strand, 36044435 - 36044496
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaatt |
342 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| |||| ||| ||||||||||| ||||| |
|
|
| T |
36044435 |
aggctaaaatatggtttaggtccctacaaatatttctcgtttcaattttagtccctataatt |
36044496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #211
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 272 - 313
Target Start/End: Original strand, 36623342 - 36623383
Alignment:
| Q |
272 |
aaatttataaggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
|||||||||||||| ||||||| |||| |||||||||||||| |
|
|
| T |
36623342 |
aaatttataaggcttaaatatgtttttcgtccctgcaaatat |
36623383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #212
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 327
Target Start/End: Complemental strand, 40493157 - 40493112
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggtt |
327 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| ||| |||||||| |
|
|
| T |
40493157 |
ggctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt |
40493112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #213
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 313
Target Start/End: Complemental strand, 1385615 - 1385583
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
1385615 |
aggcttaaatatggttttggtccctgcaaatat |
1385583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #214
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 282 - 322
Target Start/End: Original strand, 3030396 - 3030436
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattt |
322 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
3030396 |
ggcttaaatatgcttttggtccctgcaaatatgactcattt |
3030436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #215
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 305 - 337
Target Start/End: Original strand, 4709929 - 4709961
Alignment:
| Q |
305 |
tgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
4709929 |
tgcaaatatgtctcgttttggttttagtccctg |
4709961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #216
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 313
Target Start/End: Original strand, 10717120 - 10717152
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
10717120 |
aggctaaaatatgcttttggtccctgcaaatat |
10717152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #217
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 313
Target Start/End: Complemental strand, 10718508 - 10718476
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
10718508 |
aggctaaaatatgcttttggtccctgcaaatat |
10718476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #218
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 300 - 340
Target Start/End: Original strand, 26479342 - 26479382
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
26479342 |
gtccctgcaaatatttgacattttggttttagtccctgtaa |
26479382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #219
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 282 - 314
Target Start/End: Original strand, 28398756 - 28398788
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatg |
314 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
28398756 |
ggctaaaatatggttttagtccctgcaaatatg |
28398788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #220
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 300 - 340
Target Start/End: Complemental strand, 31186711 - 31186671
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
31186711 |
gtccctgcaaatatctgacattttggttttagtccctgtaa |
31186671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #221
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 313
Target Start/End: Complemental strand, 38456790 - 38456758
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
38456790 |
aggctaaaatatgcttttggtccctgcaaatat |
38456758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #222
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 43727097 - 43727153
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| ||||||||||||||| | ||||| ||||||| ||||||| |
|
|
| T |
43727097 |
ctaaaatatggttttagtccctgcaaatatgcattgttttgattttagttcctgtaa |
43727153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 60; Significance: 1e-25; HSPs: 177)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 280 - 343
Target Start/End: Original strand, 19690391 - 19690454
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19690391 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaattt |
19690454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 278 - 343
Target Start/End: Original strand, 12757606 - 12757671
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
12757606 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcactgtaattt |
12757671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 278 - 343
Target Start/End: Complemental strand, 14656264 - 14656199
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14656264 |
ataaggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgtaattt |
14656199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 10910965 - 10910906
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10910965 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
10910906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 278 - 340
Target Start/End: Complemental strand, 3276358 - 3276296
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
3276358 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaa |
3276296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 275 - 337
Target Start/End: Original strand, 21385244 - 21385306
Alignment:
| Q |
275 |
tttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21385244 |
tttaaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
21385306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 25137358 - 25137296
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
25137358 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaattt |
25137296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 3968643 - 3968700
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3968643 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3968700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 21385586 - 21385529
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21385586 |
aaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
21385529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 6412217 - 6412273
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6412217 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
6412273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 19320769 - 19320825
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19320769 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttaatccctgtaa |
19320825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 22543719 - 22543663
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22543719 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
22543663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 279 - 343
Target Start/End: Complemental strand, 23502543 - 23502479
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
23502543 |
taaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctgtaattt |
23502479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 30928679 - 30928739
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30928679 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
30928739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 1007510 - 1007451
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
1007510 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
1007451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 3414386 - 3414445
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
3414386 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
3414445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 3969010 - 3968951
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
3969010 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
3968951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 18024376 - 18024317
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18024376 |
aggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgtaa |
18024317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 280 - 343
Target Start/End: Complemental strand, 19267914 - 19267851
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19267914 |
aaggctaaaatatggttttggttcctgtaaatatgtcccattttggttttagtccctgtaattt |
19267851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 21993786 - 21993845
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21993786 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgtaa |
21993845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 25431855 - 25431796
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25431855 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
25431796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 278 - 336
Target Start/End: Original strand, 1214692 - 1214750
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1214692 |
ataaggctaaaatattgttttggtccctgcaaatatgtcgcattttggttttagtccct |
1214750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 19129521 - 19129459
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
19129521 |
aggctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtccctgtaattt |
19129459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 25121497 - 25121435
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
25121497 |
aggctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtccctgtaattt |
25121435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 3414754 - 3414697
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
3414754 |
aaggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
3414697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 23770162 - 23770219
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23770162 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
23770219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 333
Target Start/End: Complemental strand, 8170152 - 8170100
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8170152 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
8170100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 12299142 - 12299082
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
12299142 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgtaa |
12299082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 13617531 - 13617587
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgtaa |
13617587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 332
Target Start/End: Original strand, 17765007 - 17765059
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
17765007 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
17765059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 21994404 - 21994348
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
21994404 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
21994348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 22543353 - 22543409
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
22543353 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22543409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 25136992 - 25137052
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
25136992 |
aaggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccctgtaa |
25137052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 31398543 - 31398483
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31398543 |
aaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtccttgtaa |
31398483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 1007123 - 1007182
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
1007123 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaa |
1007182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 285 - 340
Target Start/End: Complemental strand, 12176640 - 12176585
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12176640 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
12176585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 21147403 - 21147462
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
21147403 |
aggctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtccctgtaa |
21147462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 282 - 333
Target Start/End: Original strand, 24901239 - 24901290
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24901239 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
24901290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 31198615 - 31198670
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
31198615 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
31198670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 279 - 337
Target Start/End: Complemental strand, 6412582 - 6412524
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
6412582 |
taaggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
6412524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 6564944 - 6564883
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
6564944 |
aggctaaaat-tggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaattt |
6564883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 10910629 - 10910687
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| ||||||||||||||||||||| |
|
|
| T |
10910629 |
ggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtccctgtaa |
10910687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 285 - 343
Target Start/End: Original strand, 12298825 - 12298883
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |||||||||||| |||||| |
|
|
| T |
12298825 |
taaaatatggttttggtccctgcaaatatgtctcgttttcgttttagtccctttaattt |
12298883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 281 - 343
Target Start/End: Original strand, 15722609 - 15722671
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
15722609 |
aggctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtccctgtaattt |
15722671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 15962389 - 15962331
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
15962389 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
15962331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 19321132 - 19321070
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||| ||||||||| |
|
|
| T |
19321132 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttactgtaattt |
19321070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 279 - 337
Target Start/End: Complemental strand, 24274134 - 24274076
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
24274134 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
24274076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 34582529 - 34582587
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
34582529 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
34582587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 284 - 337
Target Start/End: Complemental strand, 5286949 - 5286896
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
5286896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 279 - 340
Target Start/End: Original strand, 11448534 - 11448595
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
11448534 |
taaggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccccgtaa |
11448595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 279 - 336
Target Start/End: Original strand, 13268106 - 13268163
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| ||| ||||||||||||| |
|
|
| T |
13268106 |
taaggctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagtccct |
13268163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 15076206 - 15076149
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
15076206 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15076149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 33801745 - 33801688
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
33801745 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
33801688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 336
Target Start/End: Complemental strand, 1215002 - 1214942
Alignment:
| Q |
276 |
ttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||| ||||||||||||||||||| || ||||||||||||||| ||||||||||||||||| |
|
|
| T |
1215002 |
ttattaggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccct |
1214942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 7156161 - 7156105
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
7156161 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7156105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 9896280 - 9896336
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9896280 |
ctaaaatatggttttaatccctgcaaatatgtctcattttagttttagtccctgtaa |
9896336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 17765377 - 17765317
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
17765377 |
aaggctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtccctgtaa |
17765317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 20467719 - 20467663
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
20467719 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
20467663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 21995062 - 21995122
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||| ||| ||||||||||||||||||||| |
|
|
| T |
21995062 |
aaggctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctgtaa |
21995122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 24692980 - 24692924
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
24692980 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg |
24692924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 26375691 - 26375751
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
26375691 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttaatccctgtaa |
26375751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 317811 - 317870
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
317811 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagcccctgtaa |
317870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 318098 - 318039
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
318098 |
aggctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtccctgtaa |
318039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 343
Target Start/End: Original strand, 6564580 - 6564643
Alignment:
| Q |
281 |
aggctaaaatatggtttt-ggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
6564580 |
aggctaaattatggtttttggtccctgcaaatatgtctcgttttggttttagtccctataattt |
6564643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 285 - 340
Target Start/End: Original strand, 10091039 - 10091094
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| |||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaa |
10091094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 24901555 - 24901496
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||| || |||||||||||||||||||||| |
|
|
| T |
24901555 |
aggctaaaatatgattttggtccctacaaatatgacttattttggttttagtccctgtaa |
24901496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 283 - 342
Target Start/End: Complemental strand, 31276339 - 31276280
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaatt |
342 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
31276339 |
gctaaaataaagttttggtccctgcaaatatgtctcgttttgattttagtccctgtaatt |
31276280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 34582893 - 34582834
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
34582893 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctgtaa |
34582834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 494405 - 494463
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
494405 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
494463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 280 - 334
Target Start/End: Complemental strand, 9896639 - 9896585
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
9896639 |
aaggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
9896585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 275 - 337
Target Start/End: Original strand, 14655372 - 14655434
Alignment:
| Q |
275 |
tttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||||||| || |||||||||||||||||| |
|
|
| T |
14655372 |
tttattaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
14655434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 14655903 - 14655961
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| | || ||||||||||||||||||||| |
|
|
| T |
14655903 |
ggctaaaacatggttttggtccctgcaaatatatttcgttttggttttagtccctgtaa |
14655961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 19296407 - 19296349
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
19296407 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgtaa |
19296349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 285 - 339
Target Start/End: Complemental strand, 26376042 - 26375988
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
339 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgta |
26375988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 30929044 - 30928986
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
30929044 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
30928986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 283 - 337
Target Start/End: Original strand, 31166871 - 31166925
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
31166871 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
31166925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 274 - 340
Target Start/End: Complemental strand, 34990323 - 34990257
Alignment:
| Q |
274 |
atttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| ||||| |||||||||||||| ||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
34990323 |
atttttaaggttaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
34990257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 283 - 340
Target Start/End: Complemental strand, 494751 - 494694
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||| ||| ||||| |
|
|
| T |
494751 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccttgtaa |
494694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 7155795 - 7155852
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
7155795 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7155852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 8681118 - 8681061
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || |||||||||||||||||| |
|
|
| T |
8681118 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
8681061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 14428651 - 14428708
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
14428651 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaa |
14428708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 286 - 343
Target Start/End: Complemental strand, 19690755 - 19690699
Alignment:
| Q |
286 |
aaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||||||||| |||||||| |
|
|
| T |
19690755 |
aaaatatggttttggtccctgcaaatatgtctcgtttt-gttttagtccgtgtaattt |
19690699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 20467349 - 20467406
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
20467349 |
aaggataaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20467406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 22822653 - 22822596
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
22822653 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
22822596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 280 - 329
Target Start/End: Original strand, 23502235 - 23502284
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
23502235 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
23502284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 23628799 - 23628856
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||| | || |||||||||||||| |||||| |
|
|
| T |
23628799 |
gctaaaatatggttttggtccctgcaaatatatttcgttttggttttagtcactgtaa |
23628856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 283 - 340
Target Start/End: Complemental strand, 30479421 - 30479364
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| | |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
30479421 |
gctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctgtaa |
30479364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 1890453 - 1890397
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
1890453 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
1890397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 3356140 - 3356200
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || ||||||||||||||| ||||| |
|
|
| T |
3356140 |
aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccttgtaa |
3356200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 8680774 - 8680830
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
8680774 |
aggctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctg |
8680830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 11449171 - 11449111
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||| |||||||| |||||||||||| |
|
|
| T |
11449171 |
aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctgtaa |
11449111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 12419939 - 12419883
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
12419939 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
12419883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 272 - 340
Target Start/End: Complemental strand, 12612369 - 12612301
Alignment:
| Q |
272 |
aaatttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||| | ||||||||||||||| || ||||||||||||||| ||| |||| |||||||||||||||| |
|
|
| T |
12612369 |
aaattttttaggctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtccctgtaa |
12612301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 13150752 - 13150692
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13150752 |
aaggctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtccctgtaa |
13150692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 15962026 - 15962082
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||| |||||||||||||||||| |
|
|
| T |
15962026 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
15962082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 19129335 - 19129391
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
19129335 |
aggctacaatatggctttggtccctgcaaatatgcctcgttttggttttagtccctg |
19129391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 282 - 338
Target Start/End: Original strand, 19267565 - 19267621
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| || ||||||||||||||||||| |
|
|
| T |
19267565 |
ggctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtccctgt |
19267621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 22792901 - 22792841
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||| ||| |||||||||||||||| |||| |
|
|
| T |
22792901 |
aaggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccccgtaa |
22792841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 32885672 - 32885728
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
32885672 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
32885728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 33131852 - 33131792
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
33131852 |
aaggctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccctgtaa |
33131792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 286 - 337
Target Start/End: Original strand, 543365 - 543416
Alignment:
| Q |
286 |
aaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
543416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 280 - 339
Target Start/End: Original strand, 2373177 - 2373236
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
339 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || |||||||| ||||||||||| |
|
|
| T |
2373177 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtccctgta |
2373236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 336
Target Start/End: Original strand, 2615871 - 2615926
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
2615871 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
2615926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 285 - 336
Target Start/End: Complemental strand, 3356495 - 3356444
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
3356444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 285 - 340
Target Start/End: Complemental strand, 7324189 - 7324134
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| ||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
7324189 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
7324134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 285 - 340
Target Start/End: Original strand, 18024014 - 18024069
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
18024014 |
taaaatatggttttggtctttgcaaatatgcctcgttttggttttagtccctgtaa |
18024069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 31167200 - 31167145
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
31167200 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccctg |
31167145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 3968718 - 3968760
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3968718 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
3968760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 6412506 - 6412464
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6412506 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
6412464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 280 - 338
Target Start/End: Original strand, 6468308 - 6468366
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
6468308 |
aaggctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtccctgt |
6468366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 11925739 - 11925797
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||| ||||| |||||||| |||||| |
|
|
| T |
11925739 |
ggctaatatatgattttggtccctgcaaatatgtctcgttttgattttagtctctgtaa |
11925797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 294 - 340
Target Start/End: Complemental strand, 13617804 - 13617758
Alignment:
| Q |
294 |
gttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
13617804 |
gttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
13617758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 17771911 - 17771969
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || ||||||||||||||| ||||| |
|
|
| T |
17771911 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttgtaa |
17771969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 19267841 - 19267799
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19267841 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
19267799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 21385324 - 21385366
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21385324 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
21385366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 21995425 - 21995367
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||| |||||| |||||||||||||| |
|
|
| T |
21995425 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccctgtaa |
21995367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 22543645 - 22543603
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22543645 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
22543603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 336
Target Start/End: Original strand, 30239293 - 30239347
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||| |||| || |||||||||||||||| ||||||||||||||||| |
|
|
| T |
30239293 |
ggctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagtccct |
30239347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 31186591 - 31186533
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||| |||| |||||||||||||||| |
|
|
| T |
31186591 |
ggctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgttttagtccctgtaa |
31186533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 281 - 334
Target Start/End: Original strand, 12419707 - 12419760
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| ||||||||||||||| |
|
|
| T |
12419707 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
12419760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 271 - 340
Target Start/End: Original strand, 19296097 - 19296166
Alignment:
| Q |
271 |
taaatttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||| |||||||||| |||||||| ||||||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
19296097 |
taaattttaaaggctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtccctgtaa |
19296166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 24273826 - 24273883
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || ||||||||||||| |||| |
|
|
| T |
24273826 |
aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagttcctg |
24273883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 284 - 332
Target Start/End: Complemental strand, 6591440 - 6591392
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
||||||||||||||| || |||||||||||||||| ||||||||||||| |
|
|
| T |
6591440 |
ctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagt |
6591392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 283 - 327
Target Start/End: Original strand, 27764914 - 27764958
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggtt |
327 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
27764914 |
gctaaaatatggttttagtccctacaaatatgtctcattttggtt |
27764958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 281 - 343
Target Start/End: Original strand, 30479062 - 30479121
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| | |||||||| ||||||||||||| |
|
|
| T |
30479062 |
aggctaaaatatggttttggtccctgtaaatatgtcccgttttggtt---gtccctgtaattt |
30479121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 285 - 337
Target Start/End: Original strand, 31276105 - 31276157
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||| |||||||||||||||| |||||||| |||||||||||||| ||||||| |
|
|
| T |
31276105 |
taaactatggttttggtccctacaaatatgcctcattttggttttggtccctg |
31276157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 33808619 - 33808675
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| ||| ||||| |||||||||||| |
|
|
| T |
33808619 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg |
33808675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 281 - 332
Target Start/End: Complemental strand, 11926034 - 11925983
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||| | ||||||||||||| |
|
|
| T |
11926034 |
aggctaaaatatggttttggtctctgaaaatatgtcgcgttttggttttagt |
11925983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 285 - 340
Target Start/End: Complemental strand, 19276036 - 19275981
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||| ||||| |||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
19276036 |
taaaatatagttttagtccctacaaatatacctcattttggttttagtccctgtaa |
19275981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 273 - 340
Target Start/End: Original strand, 25431567 - 25431634
Alignment:
| Q |
273 |
aatttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||| |||| |||||| |||||||| || ||||| ||||||| ||||||| |
|
|
| T |
25431567 |
aatttataaggctaaaatatgattttaatccctgtaaatatgtttcgttttgattttagttcctgtaa |
25431634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 288 - 327
Target Start/End: Complemental strand, 32885960 - 32885921
Alignment:
| Q |
288 |
aatatggttttggtccctgcaaatatgtctcattttggtt |
327 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32885960 |
aatatggttttagtccctgcaaatatgtctcattttggtt |
32885921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 1007197 - 1007239
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
1007197 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
1007239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 1214767 - 1214809
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1214767 |
ttttggtccctgcaaatatgtcttgttttggttttagtccctg |
1214809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 281 - 343
Target Start/End: Original strand, 8169786 - 8169848
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||| | ||||| ||||| |||||||||||| |
|
|
| T |
8169786 |
aggctaaaatatgattttggtccatgcaaatatgttttgttttgattttactccctgtaattt |
8169848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 8170079 - 8170037
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
8170079 |
ttttggtccctacaaatatgtctcattttggttttggtccctg |
8170037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #136
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 12757936 - 12757878
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||| || ||||||||||| ||| ||||| |
|
|
| T |
12757936 |
ggctaaaacatgattttggtccctgcaaatatgtatccttttggttttaatccttgtaa |
12757878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #137
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 13268182 - 13268224
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
13268182 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
13268224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #138
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 278 - 340
Target Start/End: Complemental strand, 15117044 - 15116983
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||| |||| ||||||||| ||||| |
|
|
| T |
15117044 |
ataaggctaaaatatggttttagtccctgcaaatatgcctc-ctttgattttagtccatgtaa |
15116983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #139
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 282 - 332
Target Start/End: Original strand, 15442937 - 15442987
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||| ||||||| |
|
|
| T |
15442937 |
ggctaaaatatggttttggtccctgcaaatatacctcgttttgattttagt |
15442987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #140
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 19129447 - 19129405
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
19129447 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
19129405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #141
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 333
Target Start/End: Complemental strand, 19275223 - 19275185
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
19275223 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
19275185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #142
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 21994330 - 21994288
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
21994330 |
ttttggtccctgcaaatatgtctctttttggttttggtccctg |
21994288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #143
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 283 - 329
Target Start/End: Complemental strand, 23629101 - 23629055
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||| ||||| |
|
|
| T |
23629101 |
gctaaaatatggttttggttcctacaaatatgtctcattttagtttt |
23629055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #144
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 24901311 - 24901353
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
24901311 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
24901353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #145
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 25121424 - 25121382
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
25121424 |
ttttggtccctgcaaatatgtctcattttgattttggtccctg |
25121382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #146
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 25137066 - 25137108
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
25137066 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
25137108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #147
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 31198688 - 31198730
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
31198688 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
31198730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #148
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 777675 - 777732
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||| ||| |||||||||||||||||| |
|
|
| T |
777675 |
aaggctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtccctg |
777732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #149
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 1890057 - 1890114
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||| |||||||||||||| ||||||| ||||||| ||| ||||| |||||||||||| |
|
|
| T |
1890057 |
aaggttaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg |
1890114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #150
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 280 - 329
Target Start/End: Complemental strand, 2616242 - 2616193
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || |||||||||| |
|
|
| T |
2616242 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggtttt |
2616193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #151
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 280 - 329
Target Start/End: Original strand, 6591113 - 6591162
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||| ||| |||||||||| |
|
|
| T |
6591113 |
aaggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt |
6591162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #152
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 14428953 - 14428892
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| ||||||||||||||| |||| |||||||||| || ||||||||||||||| ||||| |
|
|
| T |
14428953 |
taagactaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccttgtaa |
14428892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #153
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 295 - 336
Target Start/End: Complemental strand, 17765302 - 17765261
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
17765302 |
ttttggtccctgcaaatatgcctcattttggttttggtccct |
17765261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #154
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 285 - 343
Target Start/End: Complemental strand, 27765173 - 27765111
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtc----tcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||| || || ||||||||||||||| |||||||| |
|
|
| T |
27765173 |
taaaatatggttttggtccctgcaaatatatctcgttcgttttggttttagtccttgtaattt |
27765111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #155
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 332
Target Start/End: Original strand, 22822305 - 22822357
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||| ||||||||||||| |
|
|
| T |
22822305 |
aaggctaaaatatggttttagtctctgcaaatatacctcgttttggttttagt |
22822357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #156
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 267 - 323
Target Start/End: Complemental strand, 23770454 - 23770398
Alignment:
| Q |
267 |
tgattaaatttataaggctaaaatatggttttggtccctgcaaatatgtctcatttt |
323 |
Q |
| |
|
|||| ||||| || |||||||||||||||||| ||||||||||||||| ||| |||| |
|
|
| T |
23770454 |
tgataaaattcattaggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #157
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 281 - 333
Target Start/End: Original strand, 25121183 - 25121234
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||| |||||||||||||| |
|
|
| T |
25121183 |
aggctaaaatatggttttcatcc-tgcaaatatgtctcgttttggttttagtc |
25121234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #158
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 281 - 332
Target Start/End: Complemental strand, 778043 - 777992
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| |||| |||||||| |
|
|
| T |
778043 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagt |
777992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #159
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 305 - 340
Target Start/End: Original strand, 7323891 - 7323926
Alignment:
| Q |
305 |
tgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
7323891 |
tgcaaatatgtctcgttttggttttagtccctgtaa |
7323926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #160
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 282 - 317
Target Start/End: Complemental strand, 13268460 - 13268425
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtct |
317 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13268460 |
ggctaaaataaggttttggtccctgcaaatatgtct |
13268425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #161
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 282 - 313
Target Start/End: Complemental strand, 20897556 - 20897525
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
20897556 |
ggctaaaatatggttttggtccctgcaaatat |
20897525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #162
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 283 - 334
Target Start/End: Original strand, 34989962 - 34990013
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||| ||||| ||||||||| |
|
|
| T |
34989962 |
gctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagtcc |
34990013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #163
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 3414679 - 3414637
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
3414679 |
ttttggtccctgcaaatatgtctcatttgtgttttggtccctg |
3414637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #164
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 12176385 - 12176443
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| | || || ||||||||||| |||| |||||||||| ||||| |
|
|
| T |
12176385 |
ggctaaaatatggttttagcccatgtaaatatgtctcgttttagttttagtccatgtaa |
12176443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #165
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 12298891 - 12298933
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||| ||||||| |
|
|
| T |
12298891 |
ttttggtccatgcaaatatgtctcgttttggttttggtccctg |
12298933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #166
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 329
Target Start/End: Original strand, 13617602 - 13617636
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
13617602 |
ttttggtccctgcaaatatgcctcattttggtttt |
13617636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #167
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 19320840 - 19320882
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||| ||||||| |
|
|
| T |
19320840 |
ttttggtccttgcaaatatgcctcattttggttttggtccctg |
19320882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #168
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 329
Target Start/End: Complemental strand, 27765101 - 27765067
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
27765101 |
ttttggtccctgcaaatatgtctcgttttggtttt |
27765067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #169
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 300 - 337
Target Start/End: Complemental strand, 3485141 - 3485104
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3485141 |
gtccctgcaaatatgtgacattttggttttagtccctg |
3485104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #170
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 280 - 313
Target Start/End: Original strand, 16995449 - 16995482
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
16995449 |
aaggctaaaatatgtttttggtccctgcaaatat |
16995482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #171
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 314
Target Start/End: Complemental strand, 17517369 - 17517336
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatg |
314 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
17517369 |
aggctaaaatatgtttttggtccctgcaaatatg |
17517336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #172
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 543725 - 543669
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| | ||||||||||| |||||| |
|
|
| T |
543725 |
aggctaaaatatgattttagtccctgcaaatatgctttgttttggttttaatccctg |
543669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #173
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 341
Target Start/End: Original strand, 1875501 - 1875561
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaat |
341 |
Q |
| |
|
|||||||||||| | ||| |||||||||||||| ||| |||||| ||| ||||||||||| |
|
|
| T |
1875501 |
aggctaaaatatagctttaatccctgcaaatatgcctcgttttgggtttggtccctgtaat |
1875561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #174
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 313
Target Start/End: Original strand, 3276366 - 3276398
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
3276366 |
aggctaaaatatgtttttggtccctgcaaatat |
3276398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #175
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 332
Target Start/End: Original strand, 15116672 - 15116721
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| |||| ||||||||||||| |
|
|
| T |
15116672 |
aggctaaaatatggttttagtcgctgcaaata--tctcgttttggttttagt |
15116721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #176
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 300 - 340
Target Start/End: Complemental strand, 17238401 - 17238361
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
17238401 |
gtccctgcaaatatctgacattttggttttagtccctgtaa |
17238361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #177
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 313
Target Start/End: Original strand, 21953205 - 21953237
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
21953205 |
aggctaaaatatgcttttggtccctgcaaatat |
21953237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 60; Significance: 1e-25; HSPs: 258)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 14488188 - 14488129
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14488188 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
14488129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 5827655 - 5827713
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5827655 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
5827713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 31560695 - 31560637
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31560695 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
31560637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 271 - 340
Target Start/End: Original strand, 2180209 - 2180278
Alignment:
| Q |
271 |
taaatttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2180209 |
taaatttttaaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
2180278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 279 - 340
Target Start/End: Original strand, 25423921 - 25423982
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25423921 |
taaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
25423982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 25424314 - 25424254
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25424314 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
25424254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 280 - 343
Target Start/End: Complemental strand, 5827975 - 5827912
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
5827975 |
aaggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctgtaattt |
5827912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 13631227 - 13631286
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13631227 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
13631286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 35464017 - 35464076
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35464017 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
35464076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 12152494 - 12152432
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
12152494 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtccctgtaattt |
12152432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 13073759 - 13073817
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13073759 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
13073817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 29420538 - 29420476
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
29420538 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctataattt |
29420476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 282 - 343
Target Start/End: Original strand, 13764613 - 13764674
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
13764613 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctgtaattt |
13764674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 14791808 - 14791751
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14791808 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
14791751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 43231086 - 43231143
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43231086 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
43231143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 283 - 340
Target Start/End: Complemental strand, 47136170 - 47136113
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccttgtaa |
47136113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 275 - 340
Target Start/End: Original strand, 52017498 - 52017563
Alignment:
| Q |
275 |
tttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
52017498 |
tttataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
52017563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 278 - 343
Target Start/End: Complemental strand, 54903479 - 54903414
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||| |
|
|
| T |
54903479 |
ataaggctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtccctgtaattt |
54903414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 13530715 - 13530655
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
13530715 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
13530655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 24774043 - 24774103
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
24774043 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
24774103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 279 - 343
Target Start/End: Original strand, 31811922 - 31811986
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
31811922 |
taaggctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtccctgtaattt |
31811986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 31812215 - 31812155
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31812215 |
aaggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgtaa |
31812155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 283 - 343
Target Start/End: Original strand, 36050289 - 36050349
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36050289 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctgtaattt |
36050349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 36054152 - 36054092
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36054152 |
aaggctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
36054092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 279 - 343
Target Start/End: Original strand, 36701997 - 36702061
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
36701997 |
taaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaattt |
36702061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 42848025 - 42848085
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42848025 |
aaggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgtaa |
42848085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 43231391 - 43231331
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
43231391 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
43231331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 11693122 - 11693063
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
11693122 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctgtaa |
11693063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 13479612 - 13479553
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13479612 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
13479553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 278 - 337
Target Start/End: Complemental strand, 13631603 - 13631544
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
13631603 |
ataaggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg |
13631544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 23245596 - 23245537
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23245596 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgtaa |
23245537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 279 - 338
Target Start/End: Complemental strand, 23779228 - 23779169
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23779228 |
taaggctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtccctgt |
23779169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 280 - 343
Target Start/End: Complemental strand, 26314334 - 26314271
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26314334 |
aaggctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctgtaattt |
26314271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 280 - 343
Target Start/End: Complemental strand, 54208827 - 54208764
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
54208827 |
aaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaattt |
54208764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 285 - 343
Target Start/End: Original strand, 14791502 - 14791560
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtctctgtaattt |
14791560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 19321859 - 19321801
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
19321859 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaa |
19321801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 281 - 343
Target Start/End: Original strand, 19903260 - 19903322
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19903260 |
aggctaaaatatagttttgatccctgcaaatatgtctcattttgattttagtccctgtaattt |
19903322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 281 - 343
Target Start/End: Original strand, 26412189 - 26412251
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
26412189 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgcaattt |
26412251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 46115414 - 46115472
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
46115414 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
46115472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 46128548 - 46128606
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
46128548 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
46128606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 278 - 340
Target Start/End: Complemental strand, 52017874 - 52017812
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
52017874 |
ataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
52017812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 274 - 340
Target Start/End: Complemental strand, 52442100 - 52442034
Alignment:
| Q |
274 |
atttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||| ||||||||||||||||||| |||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52442100 |
atttagaaggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgtaa |
52442034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 53308068 - 53308010
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
53308068 |
ggctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctgtaa |
53308010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 281 - 334
Target Start/End: Original strand, 14594205 - 14594258
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14594205 |
aggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
14594258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 22099915 - 22099854
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
22099915 |
taaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtctctgtaa |
22099854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 275 - 340
Target Start/End: Complemental strand, 29380917 - 29380852
Alignment:
| Q |
275 |
tttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
29380917 |
tttaaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
29380852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 29499180 - 29499237
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
29499180 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 30046794 - 30046737
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
30046794 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30046737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 30061135 - 30061078
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
30061135 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
30061078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 281 - 334
Target Start/End: Complemental strand, 41346219 - 41346166
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41346219 |
aggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
41346166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 123533 - 123589
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
123533 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
123589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 2322434 - 2322374
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
2322434 |
aaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtgcctgtaa |
2322374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 9289265 - 9289321
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9289265 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
9289321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 13064467 - 13064407
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
13064467 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
13064407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 16712693 - 16712633
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
16712693 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
16712633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 284 - 340
Target Start/End: Complemental strand, 19903653 - 19903597
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccatgtaa |
19903597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 336
Target Start/End: Complemental strand, 24474965 - 24474909
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24474965 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
24474909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 34361801 - 34361861
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
34361801 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
34361861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 46088061 - 46088005
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46088061 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
46088005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 46292653 - 46292593
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
46292653 |
aaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtctctgtaa |
46292593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 53916048 - 53915992
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
53916048 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
53915992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 280 - 343
Target Start/End: Complemental strand, 2034857 - 2034794
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
2034857 |
aaggctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctgtaattt |
2034794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 14487801 - 14487860
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||| |
|
|
| T |
14487801 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgtaa |
14487860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 23245231 - 23245286
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
23245231 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23245286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 26412584 - 26412529
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
26412584 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
26412529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 278 - 337
Target Start/End: Complemental strand, 29499550 - 29499491
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
29499550 |
ataaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29499491 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 280 - 343
Target Start/End: Original strand, 35119290 - 35119353
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
35119290 |
aaggctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtccctgtaattt |
35119353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 284 - 343
Target Start/End: Complemental strand, 35420701 - 35420642
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35420701 |
ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctgtaattt |
35420642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 35464382 - 35464327
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
35464382 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35464327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 42823775 - 42823834
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
42823775 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtacctgtaa |
42823834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 42848391 - 42848336
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
42848391 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
42848336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 50714240 - 50714295
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50714240 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
50714295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 50714565 - 50714510
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
50714565 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
50714510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 51738136 - 51738195
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||| ||||||||| |
|
|
| T |
51738136 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttactccctgtaa |
51738195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 52430101 - 52430042
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
52430101 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgtaa |
52430042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 52441762 - 52441821
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
52441762 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
52441821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 277 - 340
Target Start/End: Complemental strand, 53717179 - 53717116
Alignment:
| Q |
277 |
tataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
53717179 |
tatatggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
53717116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 13074126 - 13074064
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |||||||| |
|
|
| T |
13074126 |
aggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccttgtaattt |
13074064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 278 - 340
Target Start/End: Complemental strand, 13764811 - 13764749
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| || ||||||||||||||| ||||| |
|
|
| T |
13764811 |
ataaggctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagtccatgtaa |
13764749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 274 - 336
Target Start/End: Original strand, 18205148 - 18205210
Alignment:
| Q |
274 |
atttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
18205148 |
atttttaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
18205210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 280 - 338
Target Start/End: Complemental strand, 32365485 - 32365427
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
32365485 |
aaggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgt |
32365427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 278 - 336
Target Start/End: Original strand, 47022736 - 47022794
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
47022736 |
ataaggataaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccct |
47022794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 283 - 340
Target Start/End: Complemental strand, 6353637 - 6353580
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
6353637 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgtaa |
6353580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 279 - 340
Target Start/End: Original strand, 8760601 - 8760662
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8760601 |
taaggctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtccctgtaa |
8760662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 282 - 343
Target Start/End: Original strand, 26313988 - 26314049
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
26313988 |
ggctaaaatatggttttgatccctgcaaatatgttccgttttggttttagtccctgtaattt |
26314049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 279 - 336
Target Start/End: Original strand, 32208539 - 32208596
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
32208539 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
32208596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 41345851 - 41345908
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
41345851 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41345908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 333
Target Start/End: Original strand, 44925483 - 44925536
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
44925483 |
aaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
44925536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 46115781 - 46115724
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
46115781 |
aaggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46115724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 46128915 - 46128858
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
46128915 |
aaggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctg |
46128858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 333
Target Start/End: Complemental strand, 51709029 - 51708976
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
51709029 |
aaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
51708976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 283 - 340
Target Start/End: Complemental strand, 51763201 - 51763144
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
51763201 |
gctaaaatatagttttggtccctgcaaatatgcctcattttggttttagttcctgtaa |
51763144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 4211560 - 4211616
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
4211560 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
4211616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 8760783 - 8760723
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
8760783 |
aaggctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctgtaa |
8760723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 9289640 - 9289584
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9289640 |
aggcttaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
9289584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 13530378 - 13530434
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
13530378 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
13530434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 284 - 340
Target Start/End: Complemental strand, 18205521 - 18205465
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaa |
18205465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 279 - 343
Target Start/End: Complemental strand, 28449217 - 28449153
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| ||||| ||||| ||| |||||||| |
|
|
| T |
28449217 |
taaggctaaaatatggttttggtccttgcaaatatgtctcgttttgattttaatccatgtaattt |
28449153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 29463915 - 29463855
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||| |||||||||| |
|
|
| T |
29463915 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttggtccctgtaa |
29463855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 35763646 - 35763702
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
35763646 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35763702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 283 - 343
Target Start/End: Complemental strand, 37557194 - 37557134
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
37557194 |
gctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtccctgtaattt |
37557134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 38054544 - 38054604
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
38054544 |
aaggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
38054604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 43368467 - 43368523
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| |||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
43368467 |
ctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaa |
43368523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 47023106 - 47023050
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || |||||||||||||||||| |
|
|
| T |
47023106 |
aggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtccctg |
47023050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 51762868 - 51762928
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51762868 |
aaggctaaaatatggtattggtctctgcaaatatgcttcattttggttttagtccctgtaa |
51762928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 53915682 - 53915738
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
53915682 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
53915738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 55072387 - 55072447
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
55072387 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
55072447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 285 - 340
Target Start/End: Original strand, 5797484 - 5797539
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5797484 |
taaaatatgattttggtctctgcaaatatgtctcgttttggttttagtccctgtaa |
5797539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 12152153 - 12152212
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||| |||||||||||||||| |
|
|
| T |
12152153 |
aggctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtccctgtaa |
12152212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 12791975 - 12791916
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
12791975 |
aggctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtccctgtaa |
12791916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 13064158 - 13064217
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
13064158 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaa |
13064217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 20291985 - 20292044
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
| T |
20291985 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtctctgtaa |
20292044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 22584286 - 22584345
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||| |||||||||||||| |||||| |
|
|
| T |
22584286 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtctctgtaa |
22584345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 25358540 - 25358485
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
25358540 |
ggctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccctg |
25358485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 35415633 - 35415578
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
35415633 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35415578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 279 - 338
Target Start/End: Original strand, 45505597 - 45505656
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
45505597 |
taaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
45505656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 45593587 - 45593528
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
45593587 |
aggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcctgtaa |
45593528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 46292392 - 46292447
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
46292392 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
46292447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 277 - 340
Target Start/End: Original strand, 51545624 - 51545687
Alignment:
| Q |
277 |
tataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
| T |
51545624 |
tataaggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtctctgtaa |
51545687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 285 - 340
Target Start/End: Complemental strand, 51545966 - 51545911
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
51545966 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
51545911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 279 - 330
Target Start/End: Original strand, 52543419 - 52543470
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
330 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
52543419 |
taaggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 53716920 - 53716979
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
53716920 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccttgtaa |
53716979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 281 - 339
Target Start/End: Original strand, 4279021 - 4279079
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
339 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
4279021 |
aggctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtccctgta |
4279079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 279 - 337
Target Start/End: Complemental strand, 6827877 - 6827819
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
6827877 |
taaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
6827819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 278 - 340
Target Start/End: Original strand, 9445945 - 9446007
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||| |||||||||| |||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
9445945 |
ataagactaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
9446007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 285 - 343
Target Start/End: Original strand, 20144423 - 20144481
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||| ||||||| ||||||||||| |
|
|
| T |
20144423 |
taaaatatggttttggtccctgcaaatatgcctcgttttagttttagaccctgtaattt |
20144481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 22099543 - 22099601
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
22099543 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
22099601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 28809011 - 28809069
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| || ||||||||||||||||||||| |
|
|
| T |
28809011 |
ggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccctgtaa |
28809069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 41324890 - 41324832
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
41324890 |
ggctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtccctgtaa |
41324832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 42824091 - 42824033
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
42824091 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagtccttgtaa |
42824033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 280 - 338
Target Start/End: Complemental strand, 45505896 - 45505838
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||| ||||| |
|
|
| T |
45505896 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
45505838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 287 - 340
Target Start/End: Original strand, 2034544 - 2034597
Alignment:
| Q |
287 |
aaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||| |||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
2034544 |
aaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
2034597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 2322094 - 2322151
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
2322094 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtacctgtaa |
2322151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 282 - 343
Target Start/End: Complemental strand, 7642652 - 7642591
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||| || ||||| |||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
7642652 |
ggctaaaatatgattatggtctctgcaaatatgtttcgttttggttttagtccctgtaattt |
7642591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 282 - 343
Target Start/End: Complemental strand, 8905234 - 8905173
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||| ||||| ||||| |||||| |
|
|
| T |
8905234 |
ggctaaaatatggttttggtccctgtaaatatgcctcattttgattttaatccctttaattt |
8905173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 11285504 - 11285561
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
11285504 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
11285561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 283 - 336
Target Start/End: Original strand, 13479273 - 13479326
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccct |
13479326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 29380666 - 29380723
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
29380666 |
aaggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttggtccctg |
29380723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 31560329 - 31560386
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| || |||||||||||||||||| |
|
|
| T |
31560329 |
aaggctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtccctg |
31560386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 281 - 338
Target Start/End: Original strand, 32365093 - 32365150
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||| ||||| |
|
|
| T |
32365093 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgt |
32365150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 281 - 334
Target Start/End: Complemental strand, 35119612 - 35119559
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||| ||||| |
|
|
| T |
35119612 |
aggctaaaatatggttttggtcactgcaaatatgtctcgttttggtttcagtcc |
35119559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 276 - 337
Target Start/End: Complemental strand, 41620262 - 41620201
Alignment:
| Q |
276 |
ttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
41620262 |
ttataaggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg |
41620201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 283 - 340
Target Start/End: Complemental strand, 44925844 - 44925787
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
44925844 |
gctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtccctgtaa |
44925787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 287 - 340
Target Start/End: Complemental strand, 47532667 - 47532614
Alignment:
| Q |
287 |
aaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
47532667 |
aaatatggttttggtccttgcaaatatgtctcgttttggttttagttcctgtaa |
47532614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 279 - 340
Target Start/End: Original strand, 50753919 - 50753980
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
50753919 |
taaggttaaaatatggttttggtccctgcaaatatatcttgttttggttttagttcctgtaa |
50753980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 287 - 335
Target Start/End: Complemental strand, 123893 - 123845
Alignment:
| Q |
287 |
aaatatggttttggtccctgcaaatatgtctcattttggttttagtccc |
335 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtccc |
123845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 295 - 335
Target Start/End: Complemental strand, 2034781 - 2034741
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccc |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2034781 |
ttttggtccctgcaaatatgtctcattttggttttagtccc |
2034741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 5052586 - 5052526
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
5052586 |
aaggctacaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
5052526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 285 - 337
Target Start/End: Complemental strand, 5797817 - 5797765
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |||||| |
|
|
| T |
5797817 |
taaaatatggttttggtccctacaaatatgtctcgttttggttttaatccctg |
5797765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 285 - 337
Target Start/End: Original strand, 15555506 - 15555558
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15555558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 284 - 340
Target Start/End: Complemental strand, 18831176 - 18831120
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
18831176 |
ctaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtccctgtaa |
18831120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 332
Target Start/End: Original strand, 23778962 - 23779014
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
23778962 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
23779014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 282 - 338
Target Start/End: Original strand, 27008084 - 27008140
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
27008084 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
27008140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 336
Target Start/End: Complemental strand, 28809182 - 28809126
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || ||||||||||||||||| |
|
|
| T |
28809182 |
aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccct |
28809126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 285 - 337
Target Start/End: Original strand, 30060772 - 30060824
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
30060772 |
taaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtccctg |
30060824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 283 - 343
Target Start/End: Original strand, 30890832 - 30890892
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||| ||||| |||||||||| |||||||| |
|
|
| T |
30890832 |
gctaaaatatggttatgatccctgcaaatatgtcttattttagttttagtccatgtaattt |
30890892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 31182506 - 31182446
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
31182506 |
aaggctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtccctgtaa |
31182446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 285 - 337
Target Start/End: Original strand, 41619902 - 41619954
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
41619902 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41619954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 50822296 - 50822236
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
50822296 |
aaggctaaaatatggttttactccatgcaaatatgtctcatgttgattttagtccctgtaa |
50822236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 281 - 333
Target Start/End: Original strand, 51708692 - 51708744
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
51708692 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
51708744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 282 - 341
Target Start/End: Complemental strand, 4279335 - 4279276
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaat |
341 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||||||||||||| |||||| |
|
|
| T |
4279335 |
ggctaaaatatgattttagtccctgcaaatatggctcgttttggttttagtccttgtaat |
4279276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 5882551 - 5882609
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
5882551 |
aggctaaaatatggttttagtcc-tgcaaatatgcctcgttttggttttagtccctgtaa |
5882609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 278 - 333
Target Start/End: Original strand, 6827542 - 6827597
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||| ||| |||||||||||||| |
|
|
| T |
6827542 |
ataaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
6827597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 278 - 333
Target Start/End: Complemental strand, 15555642 - 15555587
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
|||| |||||||||| ||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
15555642 |
ataaagctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtc |
15555587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 277 - 340
Target Start/End: Complemental strand, 20144736 - 20144673
Alignment:
| Q |
277 |
tataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||| ||| ||||||||||| |||||||| |
|
|
| T |
20144736 |
tataaggctaaaatatggttttggttcatgcaaatatgcctcgttttggttttaacccctgtaa |
20144673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 284 - 339
Target Start/End: Original strand, 30564835 - 30564890
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
339 |
Q |
| |
|
||||||||||||||| |||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
30564835 |
ctaaaatatggttttagtccctgcaaatatgttttgttttggttttagtccctgta |
30564890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 34355284 - 34355225
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| ||| ||||||||||||||||||||| |
|
|
| T |
34355284 |
aggctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtccctgtaa |
34355225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 279 - 334
Target Start/End: Complemental strand, 41921087 - 41921032
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||| || ||||||||||||||| |
|
|
| T |
41921087 |
taaggctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagtcc |
41921032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 285 - 340
Target Start/End: Complemental strand, 55072709 - 55072654
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
55072709 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgtaa |
55072654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 7642580 - 7642538
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7642580 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
7642538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 8191391 - 8191333
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||| ||||| ||||||||||| |
|
|
| T |
8191391 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgtaa |
8191333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 280 - 330
Target Start/End: Original strand, 8904884 - 8904934
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
330 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
8904884 |
aaggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 9446323 - 9446265
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||||||| |||||||||| |||||||||| |
|
|
| T |
9446323 |
ggctaaaatatgattttagtccctgtaaatatgtctcgttttggttttcgtccctgtaa |
9446265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 281 - 343
Target Start/End: Original strand, 11692761 - 11692823
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| | | ||||| ||||||||||| |||||| |
|
|
| T |
11692761 |
aggctaaaatgtggttttggtccctgcaaatatgccccgttttgattttagtccctataattt |
11692823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 23245304 - 23245346
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23245304 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
23245346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 26412511 - 26412469
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26412511 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
26412469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 279 - 337
Target Start/End: Original strand, 27427869 - 27427926
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
27427869 |
taaggctaaaatatggtttag-tccctgcaaatatggctcgttttggttttagtccctg |
27427926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 29499473 - 29499431
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29499473 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
29499431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 30060842 - 30060884
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30060842 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
30060884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 31560404 - 31560446
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31560404 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
31560446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 35464309 - 35464267
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35464309 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
35464267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 42848318 - 42848276
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42848318 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
42848276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 43231161 - 43231203
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43231161 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
43231203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 53915756 - 53915798
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
53915756 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
53915798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 55482468 - 55482410
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
55482468 |
ggctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtccctgtaa |
55482410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 7639897 - 7639954
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||| || |||||| |
|
|
| T |
7639897 |
gctaaaatatggttttggtccctacaaatatgtcttgttttggttttaatctctgtaa |
7639954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 287 - 340
Target Start/End: Complemental strand, 27008401 - 27008348
Alignment:
| Q |
287 |
aaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| ||| ||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaa |
27008348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 279 - 336
Target Start/End: Complemental strand, 32208904 - 32208847
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||| ||||| ||||||||||| |
|
|
| T |
32208904 |
taaggctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagtccct |
32208847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 283 - 340
Target Start/End: Complemental strand, 36702362 - 36702305
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| || |||||| ||||| ||| ||||||||||||||||||||| |
|
|
| T |
36702362 |
gctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtccctgtaa |
36702305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 292 - 329
Target Start/End: Original strand, 43231189 - 43231226
Alignment:
| Q |
292 |
tggttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43231189 |
tggttttggtccctgcaaatatgtctcattttggtttt |
43231226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 45474599 - 45474538
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| || ||||||||||||| |||||| |
|
|
| T |
45474599 |
taaggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtctctgtaa |
45474538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 285 - 336
Target Start/End: Original strand, 5202929 - 5202981
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctc-attttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
5202929 |
taaaatatggttttggtccctgcaaatatgcctcgtttttggttttagtccct |
5202981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 19321569 - 19321625
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||| |||||||||||| ||| ||| ||| |||||||||||||||||| |
|
|
| T |
19321569 |
aggctaaaatatgattttggtccctgtaaacatgcctcgttttggttttagtccctg |
19321625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 35415298 - 35415354
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
35415298 |
aggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg |
35415354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 35763956 - 35763900
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||| |||| ||||||||| ||||| ||| |||||||||||||||||| |
|
|
| T |
35763956 |
aggctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctg |
35763900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 285 - 337
Target Start/End: Original strand, 50822013 - 50822065
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
50822013 |
taaaatatggttttagtccctgtaaatatgattcattttggttttagtccctg |
50822065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 51738412 - 51738356
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||| ||||| |||| ||||||| |
|
|
| T |
51738412 |
aggctaaaatatggttttggtccatgcaaatatgcctcgttttgattttggtccctg |
51738356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 51830891 - 51830947
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||| ||||| ||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
51830891 |
ctaaaatatagttttagtccctgcatatatgtcttgttttggttttagtccctgtaa |
51830947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 300 - 340
Target Start/End: Original strand, 54208479 - 54208519
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
54208479 |
gtccctgcaaatatgcctcattttggttttagtccctgtaa |
54208519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 22584608 - 22584549
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||| ||||||| ||| ||||||||||| || ||||||||||||||||||||| |
|
|
| T |
22584608 |
aggctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtccctgtaa |
22584549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 284 - 339
Target Start/End: Original strand, 35420393 - 35420448
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
339 |
Q |
| |
|
||||||||||||||||||||| ||||||||| | |||||||||||||||||||| |
|
|
| T |
35420393 |
ctaaaatatggttttggtccccgcaaatatgctttgttttggttttagtccctgta |
35420448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 285 - 332
Target Start/End: Original strand, 41920771 - 41920818
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||| ||||||| |
|
|
| T |
41920771 |
taaaatatggttttagtccctgcaaatatgactcattttgattttagt |
41920818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 45593227 - 45593286
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| ||||| |||||| |||||||| ||| |||||| |||||||||||||| |
|
|
| T |
45593227 |
aggctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtccctgtaa |
45593286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 2180572 - 2180514
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| | | ||||||||||||||| ||||| |
|
|
| T |
2180572 |
ggctaaaatatagttttagtccctgcaaatatggcacgttttggttttagtccttgtaa |
2180514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 5797747 - 5797705
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
5797747 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
5797705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 13530452 - 13530494
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
13530452 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
13530494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 329
Target Start/End: Complemental strand, 13631526 - 13631492
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
13631526 |
ttttggtccctgcaaatatgtctcattttggtttt |
13631492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #208
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 329
Target Start/End: Original strand, 19321643 - 19321677
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
19321643 |
ttttggtccctgcaaatatgtctcattttggtttt |
19321677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #209
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 19903334 - 19903376
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19903334 |
ttttgatccctgcaaatatgtctcattttggttttggtccctg |
19903376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #210
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 20144492 - 20144534
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
20144492 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
20144534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #211
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 24774354 - 24774312
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
24774354 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
24774312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #212
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 25424239 - 25424197
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
25424239 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
25424197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #213
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 31811996 - 31812038
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
31811996 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
31812038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #214
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 281 - 343
Target Start/End: Original strand, 37556840 - 37556902
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||| | || ||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
37556840 |
aggctaaaatatggttttagaccttgcaaatatacctcgatttggttttagtccctgtaattt |
37556902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #215
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 47135851 - 47135893
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
47135851 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
47135893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #216
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 282 - 332
Target Start/End: Complemental strand, 47274230 - 47274180
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
||||||||||| ||||| || |||||||||||||||| ||||||||||||| |
|
|
| T |
47274230 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
47274180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #217
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 50754257 - 50754195
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||| || ||||||| || | || ||| |||||||||||||||||||| |
|
|
| T |
50754257 |
aggctaaaatatggttttgatcactgcaaacatatatcgtttaggttttagtccctgtaattt |
50754195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #218
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 51763129 - 51763087
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
51763129 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
51763087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #219
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 295 - 336
Target Start/End: Complemental strand, 14594494 - 14594453
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
14594494 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
14594453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #220
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 295 - 336
Target Start/End: Complemental strand, 54903403 - 54903362
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
54903403 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
54903362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #221
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 16712331 - 16712387
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||| ||||||| |||||| |||||| |
|
|
| T |
16712331 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtattagtctctgtaa |
16712387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #222
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 18136115 - 18136055
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| ||| ||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
18136115 |
aaggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctgtaa |
18136055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #223
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 286 - 334
Target Start/End: Complemental strand, 20292284 - 20292237
Alignment:
| Q |
286 |
aaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
||||||| |||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
20292284 |
aaaatatcgttttggtccctgcaa-tatgcctcattttggttttagtcc |
20292237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #224
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 281 - 333
Target Start/End: Original strand, 28448833 - 28448885
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
|||||||||||||||||| |||| | |||||||| ||| |||||||||||||| |
|
|
| T |
28448833 |
aggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagtc |
28448885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #225
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 304 - 340
Target Start/End: Original strand, 29420231 - 29420267
Alignment:
| Q |
304 |
ctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29420231 |
ctgcaaatatgtctcattttggttttagtccttgtaa |
29420267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #226
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 49123323 - 49123263
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| ||| ||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
49123323 |
aaggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctgtaa |
49123263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #227
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 295 - 334
Target Start/End: Complemental strand, 8905162 - 8905123
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
8905162 |
ttttggtccctgcaaatatgtctcgttttggttttcgtcc |
8905123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #228
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 283 - 334
Target Start/End: Original strand, 12791610 - 12791661
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||| |||||| |||||||||| |
|
|
| T |
12791610 |
gctaaaatatagttttagtccctgcaaatatgtgccattttcgttttagtcc |
12791661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #229
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 300 - 343
Target Start/End: Complemental strand, 22487585 - 22487542
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
22487585 |
gtccctgcaaatatttgacattttggttttagtccctgtaattt |
22487542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #230
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 24474599 - 24474657
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| || ||||||||||||||| ||||| |
|
|
| T |
24474599 |
aggctaaaatatggttttagtcc-tgcaaatatgcatcgttttggttttagtccatgtaa |
24474657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #231
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 298 - 337
Target Start/End: Complemental strand, 47023029 - 47022990
Alignment:
| Q |
298 |
tggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
47023029 |
tggtccctgcaaatatgcctcattttggttttggtccctg |
47022990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #232
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 284 - 343
Target Start/End: Complemental strand, 52543725 - 52543666
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||| ||||||| | |||||||||| ||| ||||||||||| ||| |||||||| |
|
|
| T |
52543725 |
ctaaaatatgattttggttcttgcaaatatgcctcgttttggttttaatccatgtaattt |
52543666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #233
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 298 - 337
Target Start/End: Complemental strand, 54208749 - 54208710
Alignment:
| Q |
298 |
tggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
54208749 |
tggtccctgcaaatatgcctcattttggttttggtccctg |
54208710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #234
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 329
Target Start/End: Complemental strand, 2322359 - 2322325
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
2322359 |
ttttggtccctgcaaatatgtctcgttttggtttt |
2322325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #235
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 329
Target Start/End: Complemental strand, 5203220 - 5203186
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
5203220 |
ttttggtccctgcaaatatgcctcattttggtttt |
5203186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #236
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 280 - 314
Target Start/End: Complemental strand, 5259212 - 5259178
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatg |
314 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
5259212 |
aaggctaaaatatgtttttggtccctgcaaatatg |
5259178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #237
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 14488114 - 14488072
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
14488114 |
ttttggtccctgcaaatatgcttcattttggttttggtccctg |
14488072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #238
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 289 - 339
Target Start/End: Complemental strand, 27428195 - 27428145
Alignment:
| Q |
289 |
atatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
339 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
27428195 |
atatggttttaatacctgcaaatatgtctcattttcgttttagtctctgta |
27428145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #239
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 329
Target Start/End: Original strand, 31182198 - 31182232
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31182198 |
ttttggtccctgcgaatatgtctcattttggtttt |
31182232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #240
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 280 - 314
Target Start/End: Original strand, 34659704 - 34659738
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatg |
314 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
34659704 |
aaggctaaaatatgcttttggtccctgcaaatatg |
34659738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #241
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 36050359 - 36050401
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
36050359 |
ttttggtccctgcaaatatgcctcgttttggttttggtccctg |
36050401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #242
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 280 - 310
Target Start/End: Original strand, 41324767 - 41324797
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaa |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41324767 |
aaggctaaaatatggttttggtccctgcaaa |
41324797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #243
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 285 - 343
Target Start/End: Original strand, 41439790 - 41439848
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||| | | ||| |||||| |||| |||||||||||||| ||||||||| |
|
|
| T |
41439790 |
taaaatatggttttagcctctgtaaatatttctcgttttggttttagtctctgtaattt |
41439848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #244
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 43368777 - 43368719
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| | || |||||||||| || ||||||||||||| ||||||| |
|
|
| T |
43368777 |
ggctaaaatatggttttaattccggcaaatatgtttcgttttggttttagttcctgtaa |
43368719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #245
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 46115706 - 46115664
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| ||||||| |
|
|
| T |
46115706 |
ttttggtccctgcaaatatgccttattttggttttggtccctg |
46115664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #246
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 46128840 - 46128798
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| ||||||| |
|
|
| T |
46128840 |
ttttggtccctgcaaatatgccttattttggttttggtccctg |
46128798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #247
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 8191076 - 8191133
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||| |||| ||||| ||||||||||| |||| |||||||||||||||| |
|
|
| T |
8191076 |
gctaaaatatgattttaatccctacaaatatgtcttgttttagttttagtccctgtaa |
8191133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #248
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 343
Target Start/End: Complemental strand, 14594561 - 14594504
Alignment:
| Q |
286 |
aaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||| |||| |||||| ||||||| ||| ||||||||||||| |||||||||| |
|
|
| T |
14594561 |
aaaatatgattttagtccctccaaatatttcttgttttggttttagttcctgtaattt |
14594504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #249
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 292 - 337
Target Start/End: Complemental strand, 25358499 - 25358454
Alignment:
| Q |
292 |
tggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||| | ||||||| |
|
|
| T |
25358499 |
tggttttagtccctgcaaatatgtctcgttttggttgtggtccctg |
25358454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #250
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 314
Target Start/End: Complemental strand, 30091115 - 30091082
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatg |
314 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
30091115 |
aggctaaaatatggttttggtccatgcaaatatg |
30091082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #251
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 280 - 313
Target Start/End: Original strand, 42358030 - 42358063
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
42358030 |
aaggctaaaatatgtttttggtccctgcaaatat |
42358063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #252
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 300 - 340
Target Start/End: Complemental strand, 17865343 - 17865303
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
17865343 |
gtccctgcaaatatctgacattttggttttagtccctgtaa |
17865303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #253
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 300 - 340
Target Start/End: Original strand, 26314492 - 26314532
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
26314492 |
gtccctgcaaatatctgacattttggttttagtccctgtaa |
26314532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #254
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 280 - 336
Target Start/End: Complemental strand, 28197283 - 28197227
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||| |||||||||||||| ||| || |||||||||||| | || |||||||||||| |
|
|
| T |
28197283 |
aaggttaaaatatggttttagtctctacaaatatgtctcgtctttgttttagtccct |
28197227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #255
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 282 - 330
Target Start/End: Original strand, 29463610 - 29463658
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
330 |
Q |
| |
|
||||||||||||||||| | |||||||||||| ||| ||||||||||| |
|
|
| T |
29463610 |
ggctaaaatatggttttatttcctgcaaatatgcctcgttttggtttta |
29463658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #256
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 47135776 - 47135836
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| ||||| ||| |||||||| ||| |||||| |||| ||||||||||||| ||||||| |
|
|
| T |
47135776 |
aaggttaaaacatgattttggtctctgtaaatatatctcgttttggttttagttcctgtaa |
47135836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #257
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 297 - 329
Target Start/End: Original strand, 53307829 - 53307861
Alignment:
| Q |
297 |
ttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
53307829 |
ttggtccctgcaaatatgtctcgttttggtttt |
53307861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #258
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 282 - 334
Target Start/End: Complemental strand, 55805088 - 55805036
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
||||||||||| |||||||| | |||||||||| || ||||||||||||||| |
|
|
| T |
55805088 |
ggctaaaatatagttttggttcttgcaaatatgccttgttttggttttagtcc |
55805036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 60; Significance: 1e-25; HSPs: 227)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 269 - 340
Target Start/End: Original strand, 18113076 - 18113147
Alignment:
| Q |
269 |
attaaatttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
18113076 |
attaaatttataaggctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctgtaa |
18113147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 278 - 343
Target Start/End: Original strand, 16522987 - 16523052
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
16522987 |
ataaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaattt |
16523052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 16673409 - 16673466
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16673409 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
16673466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 4424187 - 4424127
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4424187 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
4424127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 25705083 - 25705143
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25705083 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
25705143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 13215059 - 13215118
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13215059 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
13215118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 44559061 - 44559120
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44559061 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
44559120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 281 - 343
Target Start/End: Original strand, 10671629 - 10671691
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
10671629 |
aggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctgtaattt |
10671691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 11788417 - 11788355
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11788417 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaattt |
11788355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 277 - 343
Target Start/End: Complemental strand, 36815840 - 36815774
Alignment:
| Q |
277 |
tataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
36815840 |
tataaggctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcctgtaattt |
36815774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 2481560 - 2481499
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
2481560 |
taaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
2481499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 279 - 340
Target Start/End: Original strand, 4423892 - 4423953
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
4423892 |
taaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
4423953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 280 - 341
Target Start/End: Complemental strand, 17302145 - 17302084
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaat |
341 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17302145 |
aaggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctgtaat |
17302084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 283 - 340
Target Start/End: Complemental strand, 20939324 - 20939267
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20939324 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
20939267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 29859875 - 29859814
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
29859875 |
taaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
29859814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 33576119 - 33576062
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33576119 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33576062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 282 - 343
Target Start/End: Original strand, 40124966 - 40125027
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
40124966 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttcctgtaattt |
40125027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 271 - 340
Target Start/End: Complemental strand, 40125300 - 40125231
Alignment:
| Q |
271 |
taaatttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
40125300 |
taaatttttaaggctaaaatatgattttggtccctgcaaatatgcctcatttttgttttagtccctgtaa |
40125231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 20131316 - 20131372
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20131316 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
20131372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 31644839 - 31644899
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
31644839 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaa |
31644899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 32476093 - 32476153
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32476093 |
aaggctaaaatatggttttgatccctgcaaatatgcctcattttggttttagtccctgtaa |
32476153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 41451836 - 41451892
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41451836 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
41451892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 282 - 342
Target Start/End: Original strand, 42695868 - 42695928
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaatt |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
42695868 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctataatt |
42695928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 16523326 - 16523267
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
16523326 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
16523267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 280 - 343
Target Start/End: Original strand, 37228731 - 37228794
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||||||||||| ||||||||| |
|
|
| T |
37228731 |
aaggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagtctctgtaattt |
37228794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 146690 - 146632
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
146690 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaa |
146632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 1138360 - 1138298
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
1138360 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctgtaattt |
1138298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 11713485 - 11713543
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
11713485 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
11713543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 279 - 337
Target Start/End: Complemental strand, 15842826 - 15842768
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
15842826 |
taaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 36622250 - 36622308
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36622250 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
36622308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 286 - 340
Target Start/End: Complemental strand, 36806892 - 36806838
Alignment:
| Q |
286 |
aaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36806892 |
aaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
36806838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 14003744 - 14003687
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
14003744 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
14003687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 19183780 - 19183837
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19183780 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
19183837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 279 - 340
Target Start/End: Original strand, 33732859 - 33732920
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
33732859 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
33732920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 282 - 343
Target Start/End: Original strand, 34317798 - 34317859
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
34317798 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaattt |
34317859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 282 - 343
Target Start/End: Complemental strand, 34964159 - 34964098
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| ||||||| ||||||||||| |
|
|
| T |
34964159 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagcccctgtaattt |
34964098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 3172018 - 3172078
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
3172018 |
aaggctaaaatatgattttggtccctgcaaatatgcctcattttggttttagtccatgtaa |
3172078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 24358615 - 24358671
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
24358615 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24358671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 24483893 - 24483833
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
24483893 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
24483833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 25705450 - 25705394
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
25705450 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25705394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 33575751 - 33575807
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33575751 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
33575807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 40301973 - 40302033
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
40301973 |
aaggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctgtaa |
40302033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 41693672 - 41693732
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
41693672 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaa |
41693732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 284 - 340
Target Start/End: Complemental strand, 44559407 - 44559351
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaa |
44559351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 284 - 343
Target Start/End: Original strand, 1137983 - 1138042
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgtaattt |
1138042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 4794130 - 4794185
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4794130 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
4794185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 5334751 - 5334806
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
5334751 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 5335040 - 5334985
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
5335040 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5334985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 5790899 - 5790844
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5790899 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
5790844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 277 - 340
Target Start/End: Complemental strand, 10375074 - 10375011
Alignment:
| Q |
277 |
tataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
10375074 |
tatatggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccctgtaa |
10375011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 10671942 - 10671883
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
10671942 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
10671883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 278 - 337
Target Start/End: Complemental strand, 16900210 - 16900151
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
16900210 |
ataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16900151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 278 - 337
Target Start/End: Complemental strand, 16993601 - 16993542
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
16993601 |
ataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16993542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 20131681 - 20131626
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
20131681 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20131626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 26813866 - 26813921
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26813866 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
26813921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 280 - 343
Target Start/End: Original strand, 29182166 - 29182229
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
29182166 |
aaggctaaaatatgattttggtccttgcaaatatgtttcattttggttttagtctctgtaattt |
29182229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 30215872 - 30215813
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || | ||||||||||||||||||||| |
|
|
| T |
30215872 |
aggctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccctgtaa |
30215813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 278 - 337
Target Start/End: Complemental strand, 37272106 - 37272047
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
37272106 |
ataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37272047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 40302340 - 40302281
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
40302340 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctgtaa |
40302281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 44985985 - 44985926
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44985985 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaa |
44985926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 274 - 340
Target Start/End: Original strand, 3837925 - 3837991
Alignment:
| Q |
274 |
atttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||| ||||||||||||| ||||| ||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
3837925 |
atttacaaggctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtccctgtaa |
3837991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 12835325 - 12835383
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12835325 |
ggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
12835383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 31909479 - 31909418
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||||||| |
|
|
| T |
31909479 |
aggctaaaatatggttttggtccctgcaaatatgcctc-ttttggttttagtctctgtaattt |
31909418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 278 - 340
Target Start/End: Original strand, 38731825 - 38731887
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
38731825 |
ataaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
38731887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 284 - 337
Target Start/End: Original strand, 146328 - 146381
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
146328 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
146381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 2265400 - 2265339
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| |||| |||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2265400 |
taaggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccctgtaa |
2265339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 2481191 - 2481248
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||| |||||||||||||||||| |
|
|
| T |
2481191 |
aaggctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtccctg |
2481248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 281 - 338
Target Start/End: Complemental strand, 7814738 - 7814681
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7814738 |
aggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctgt |
7814681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 282 - 339
Target Start/End: Original strand, 9195054 - 9195111
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
339 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
9195054 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgta |
9195111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 19184153 - 19184096
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
19184153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19184096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 279 - 340
Target Start/End: Original strand, 22881610 - 22881671
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
22881610 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
22881671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 24358947 - 24358890
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
24358947 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24358890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 26814231 - 26814174
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
26814231 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26814174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 30215420 - 30215477
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
30215420 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
30215477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 37271737 - 37271794
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
37271737 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37271794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 37911123 - 37911062
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||||| |
|
|
| T |
37911123 |
taaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccctgtaa |
37911062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 38980255 - 38980198
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
38980255 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
38980198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 43597502 - 43597441
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| |||| |||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
43597502 |
taaggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgtaa |
43597441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 282 - 334
Target Start/End: Complemental strand, 4042890 - 4042838
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4042890 |
ggctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagtcc |
4042838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 8046327 - 8046387
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
8046327 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgtaa |
8046387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 11713847 - 11713787
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
11713847 |
aaggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
11713787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 14003408 - 14003464
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
14003408 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
14003464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 285 - 337
Target Start/End: Original strand, 15842464 - 15842516
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
15842464 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
15842516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 16673772 - 16673716
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||| ||||||||||||| |
|
|
| T |
16673772 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctg |
16673716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 26238811 - 26238871
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
26238811 |
aaggttaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
26238871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 26239161 - 26239105
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
26239161 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
26239105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 285 - 337
Target Start/End: Original strand, 29859490 - 29859542
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29859542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 333
Target Start/End: Original strand, 38639411 - 38639463
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
38639411 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
38639463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 41791020 - 41791076
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgtaa |
41791076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 42358697 - 42358757
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
42358697 |
aaggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
42358757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 340
Target Start/End: Original strand, 43592040 - 43592104
Alignment:
| Q |
276 |
ttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| |||||||||||||||||| |||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
43592040 |
ttattaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaa |
43592104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 43672320 - 43672260
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
43672320 |
aaggctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtccctgtaa |
43672260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 44985623 - 44985679
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
44985623 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
44985679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 280 - 343
Target Start/End: Complemental strand, 3172534 - 3172471
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| ||| ||||||||||||||| |||||||| |
|
|
| T |
3172534 |
aaggctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagtccatgtaattt |
3172471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 9195207 - 9195148
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
9195207 |
aggctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccctgtaa |
9195148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 10664983 - 10665042
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||| | ||||||||||||| |
|
|
| T |
10664983 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccctgtaa |
10665042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 279 - 334
Target Start/End: Complemental strand, 17541779 - 17541724
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
17541779 |
taaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
17541724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 280 - 339
Target Start/End: Complemental strand, 35155621 - 35155562
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
339 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| ||||| |||||||||||||| |
|
|
| T |
35155621 |
aaggctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtccctgta |
35155562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 37910755 - 37910814
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| |||||||| |||||||||||||||| |
|
|
| T |
37910755 |
aggctaaaatatggttttgatccttgcaaatatgcctcattttagttttagtccctgtaa |
37910814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 40786459 - 40786518
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40786459 |
aggctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtccctgtaa |
40786518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 43597153 - 43597212
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
43597153 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgtaa |
43597212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 285 - 343
Target Start/End: Complemental strand, 1295544 - 1295486
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||| | ||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
1295544 |
taaaatatggttttgattcctgcaaatatgtttcgttttggttttagtccctgtaattt |
1295486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 280 - 334
Target Start/End: Original strand, 4042608 - 4042662
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||| ||||||||||||||| |
|
|
| T |
4042608 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
4042662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 8046648 - 8046590
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
8046648 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaa |
8046590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 23732039 - 23732097
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
23732039 |
ggctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccatgtaa |
23732097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 336
Target Start/End: Original strand, 27109073 - 27109127
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||| ||||||||||||||||| |
|
|
| T |
27109073 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtccct |
27109127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 41694003 - 41693945
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
41694003 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
41693945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 279 - 337
Target Start/End: Complemental strand, 44073810 - 44073752
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
44073810 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
44073752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 276 - 334
Target Start/End: Complemental strand, 45442702 - 45442644
Alignment:
| Q |
276 |
ttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||||| |||| |||| |||||||||||||| ||||||||||||||| |
|
|
| T |
45442702 |
ttataaggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtcc |
45442644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 283 - 340
Target Start/End: Complemental strand, 3838263 - 3838206
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
3838263 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
3838206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 287 - 340
Target Start/End: Complemental strand, 4794468 - 4794415
Alignment:
| Q |
287 |
aaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||| |||||| |
|
|
| T |
4794468 |
aaatatggttttggtccctacaaatatgtctcgttttggttttagtctctgtaa |
4794415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 283 - 336
Target Start/End: Original strand, 4842865 - 4842918
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
4842865 |
gctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagtccct |
4842918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 10374775 - 10374832
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
10374775 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
10374832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 17541380 - 17541437
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||| ||| |||||||||||||||||| |
|
|
| T |
17541380 |
aaggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
17541437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 29865222 - 29865279
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
29865279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 282 - 343
Target Start/End: Complemental strand, 34318083 - 34318022
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||| ||||| ||||||||| |||||||| |
|
|
| T |
34318083 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttgattttagtccttgtaattt |
34318022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 283 - 340
Target Start/End: Complemental strand, 42696202 - 42696145
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
42696202 |
gctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccatgtaa |
42696145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 281 - 334
Target Start/End: Original strand, 43788857 - 43788910
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
43788857 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
43788910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 282 - 338
Target Start/End: Complemental strand, 3671192 - 3671136
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
3671192 |
ggctcaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
3671136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 285 - 333
Target Start/End: Complemental strand, 3832634 - 3832586
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
3832634 |
taaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
3832586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 281 - 329
Target Start/End: Complemental strand, 13215366 - 13215318
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
13215366 |
aggctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt |
13215318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 23732330 - 23732271
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||| |||||| |||||||||||||| |
|
|
| T |
23732330 |
aaggctaaaatatggttttggtctctgcaaatatgcctcgttttgg-tttagtccctgtaa |
23732271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 25954113 - 25954173
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||| || ||||||||||||||| ||||| |
|
|
| T |
25954113 |
aaggctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtccttgtaa |
25954173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 27310874 - 27310933
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||| |||||||||||||| |
|
|
| T |
27310874 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttgg-tttagtccctgtaa |
27310933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 43592382 - 43592322
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| |||| |||||||| |||||||||||||||| ||||||||| ||||| |
|
|
| T |
43592382 |
aaggctaaaatatgattttagtccctgctaatatgtctcattttgattttagtccttgtaa |
43592322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 279 - 343
Target Start/End: Original strand, 43671931 - 43671995
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| || ||||||||||||| |||||||||| |
|
|
| T |
43671931 |
taaggctaaaatatggtttttgtccctgtaaatatgcttcgttttggttttagttcctgtaattt |
43671995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 44994063 - 44994003
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |||| ||||||||| |||||| |
|
|
| T |
44994063 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagtctctgtaa |
44994003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 5790558 - 5790613
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||| || ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
5790558 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg |
5790613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 13850521 - 13850580
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| |||||| || ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13850521 |
aggctaaaatatagttttgatctctgcaaatatgtctcgatttggttttagtccctgtaa |
13850580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 20658060 - 20658119
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
20658060 |
aggctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaa |
20658119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 336
Target Start/End: Complemental strand, 27311070 - 27311015
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||| ||||||||||||||||| |
|
|
| T |
27311070 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccct |
27311015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 29865512 - 29865453
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| || ||||||||||||||||||||| |
|
|
| T |
29865512 |
aggctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctgtaa |
29865453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 36815487 - 36815546
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| | ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
36815487 |
aggctaaaatatggttttgccctctgtaaatatgtctcgttttggttttagtccctgtaa |
36815546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 274 - 337
Target Start/End: Complemental strand, 43789200 - 43789137
Alignment:
| Q |
274 |
atttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||| |||||||||||||||||||| || |||||||||||| || |||||||||||||||||| |
|
|
| T |
43789200 |
atttttaaggctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccctg |
43789137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 146399 - 146441
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
146399 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
146441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 1497610 - 1497668
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
1497610 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgtaa |
1497668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 2481266 - 2481308
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2481266 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
2481308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 5334967 - 5334925
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5334967 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
5334925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 285 - 343
Target Start/End: Complemental strand, 13850881 - 13850823
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||| |||||||||||| || |||||||||||||| ||||||||| |
|
|
| T |
13850881 |
taaaatatggttttggttcctgcaaatatgcttcgttttggttttagtctctgtaattt |
13850823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 15842534 - 15842576
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15842534 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
15842576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 16673484 - 16673526
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16673484 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
16673526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 18113454 - 18113396
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| || ||||||||||| ||||||||| |
|
|
| T |
18113454 |
ggctaaaatatggttttggtccctacaaatatgcttcgttttggttttaatccctgtaa |
18113396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 20131390 - 20131432
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
20131390 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
20131432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 23732256 - 23732214
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23732256 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
23732214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 24358872 - 24358830
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24358872 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
24358830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 25705376 - 25705334
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25705376 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
25705334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 29859560 - 29859602
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29859560 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
29859602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 30215495 - 30215537
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30215495 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
30215537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 31226077 - 31226019
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
31226077 |
ggctaaaatatggttttactccctgcaaatatgcctcgttttggttttactccctgtaa |
31226019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 336
Target Start/End: Complemental strand, 33733241 - 33733187
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||| ||||| |
|
|
| T |
33733241 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccct |
33733187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 288 - 334
Target Start/End: Original strand, 35155298 - 35155344
Alignment:
| Q |
288 |
aatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
35155344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 40125039 - 40125081
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40125039 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
40125081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 281 - 338
Target Start/End: Original strand, 3671002 - 3671059
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||| ||||| ||||||||||||| |
|
|
| T |
3671002 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccctgt |
3671059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 7814244 - 7814301
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||| ||||| ||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
7814244 |
aaggctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccctg |
7814301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 279 - 340
Target Start/End: Original strand, 16968549 - 16968610
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||| |||||||||||||| |||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
16968549 |
taaggttaaaatatggttttagtccctacaaatatgccttgttttggttttagtccctgtaa |
16968610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 24483401 - 24483458
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
24483401 |
gctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtccctgtaa |
24483458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 25954429 - 25954368
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||| |||||||||||||| |||| |||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
25954429 |
taaggttaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctgtaa |
25954368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 292 - 337
Target Start/End: Complemental strand, 33576076 - 33576031
Alignment:
| Q |
292 |
tggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33576076 |
tggttttagtccctgcaaatatgtctcattttggttttggtccctg |
33576031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 43710711 - 43710650
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| |||| | || |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
43710711 |
taaggctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtccctgtaa |
43710650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 332
Target Start/End: Original strand, 5006605 - 5006657
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||| |||| ||||||||||||| |
|
|
| T |
5006605 |
aaggttaaaatatggttttggtctctgcaaatatatctcgttttggttttagt |
5006657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 285 - 333
Target Start/End: Original strand, 17912452 - 17912500
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
17912452 |
taaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
17912500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 300 - 340
Target Start/End: Complemental strand, 22881950 - 22881910
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22881950 |
gtccctgcaaatatgtctcgttttggttttagtccctgtaa |
22881910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 281 - 333
Target Start/End: Original strand, 23989837 - 23989889
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
23989837 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
23989889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 285 - 333
Target Start/End: Complemental strand, 23990193 - 23990145
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| |||||||||||||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
23990145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 25299747 - 25299803
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||| |||| ||||||||||||||| |
|
|
| T |
25299747 |
ctaaaatatgattttggtccctgcaaatatgactcgttttaattttagtccctgtaa |
25299803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 284 - 332
Target Start/End: Complemental strand, 25300038 - 25299991
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
25300038 |
ctaaaatatggttttggtccctgcaaatatgtttc-ttttggttttagt |
25299991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 284 - 332
Target Start/End: Complemental strand, 29182440 - 29182392
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
29182440 |
ctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagt |
29182392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 328
Target Start/End: Original strand, 29831812 - 29831860
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttt |
328 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||| ||||||||| |
|
|
| T |
29831812 |
aaggctaaaatatagttttgatccctgcaaatatgtctcgttttggttt |
29831860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #169
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 31225713 - 31225773
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| ||| ||||| ||||||| ||||||| |
|
|
| T |
31225713 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagttcctgtaa |
31225773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #170
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 31326254 - 31326194
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| ||||| |||| |||||||||| ||| |||| |||||||||||||||| |
|
|
| T |
31326254 |
aaggctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtccctgtaa |
31326194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #171
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 38979889 - 38979945
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatat-gtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
38979889 |
ggctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtccctg |
38979945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #172
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 280 - 343
Target Start/End: Original strand, 17301982 - 17302043
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||| |||| ||||||||||||||||| |||||| |
|
|
| T |
17301982 |
aaggctaaaatatggttttggt-cctgaaaatat-tctcgttttggttttagtccctataattt |
17302043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #173
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 19604978 - 19604923
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| ||||||| |||||| ||||||| |
|
|
| T |
19604978 |
ggctaaaatatgtttttggtccctgtaaatatggctcatttgggttttggtccctg |
19604923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #174
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 26707872 - 26707931
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
26707872 |
aggctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtccctgtaa |
26707931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #175
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 32691312 - 32691371
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
32691312 |
aggctaaaatatggttttagtttctgcaaatatgcctcgttttggttttaatccctgtaa |
32691371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #176
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 285 - 332
Target Start/End: Complemental strand, 37229039 - 37228992
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
||||||||||||||||||||||||||||| | || ||||||||||||| |
|
|
| T |
37229039 |
taaaatatggttttggtccctgcaaatatatttcgttttggttttagt |
37228992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #177
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 295 - 334
Target Start/End: Original strand, 42695941 - 42695980
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42695941 |
ttttggtccctgcaaatatgtctcattttggttttggtcc |
42695980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #178
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 284 - 343
Target Start/End: Original strand, 44993806 - 44993864
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||| | |||| |||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
44993806 |
ctaaaatatggttgtagtcc-tgcaaatatgtctcgttttggttttactccctgtaattt |
44993864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #179
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 4423968 - 4424010
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
4423968 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
4424010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #180
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 4794203 - 4794245
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
4794203 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
4794245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #181
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 280 - 343
Target Start/End: Original strand, 5163951 - 5164010
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||| || | ||||||| |||||||||||||||||||||||| |
|
|
| T |
5163951 |
aaggctaaaatatggttttggtctct----acatgtctcgttttggttttagtccctgtaattt |
5164010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #182
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 14003482 - 14003524
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
14003482 |
ttttggtccctgcaaatatgtctcattttagttttggtccctg |
14003524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #183
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 20658410 - 20658349
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttg--gttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
20658410 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttttagtccctgtaa |
20658349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #184
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 31325920 - 31325978
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| | ||||||||||||||| || |||| |||||||||||||||| |
|
|
| T |
31325920 |
ggctaaaatatggttctagtccctgcaaatatgcatcgttttagttttagtccctgtaa |
31325978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #185
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 31909406 - 31909364
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
31909406 |
ttttggtccctgcaaatatgtctaattttggttttggtccctg |
31909364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #186
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 41451910 - 41451952
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41451910 |
ttttgatccctgcaaatatgtctcattttggttttggtccctg |
41451952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #187
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 41791312 - 41791254
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || ||||||||| |||| |||||| |
|
|
| T |
41791312 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttaagtctctgtaa |
41791254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #188
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 329
Target Start/End: Complemental strand, 44559336 - 44559302
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
44559336 |
ttttggtccctgcaaatatgtctcattttggtttt |
44559302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #189
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 284 - 337
Target Start/End: Complemental strand, 1497943 - 1497890
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||| |||||||||||||||||| |
|
|
| T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtccctg |
1497890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #190
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 14393131 - 14393071
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| ||| | ||| |||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
14393131 |
taaggctaaaatatgatttagttcc-tgcaaatatgtctcgttttggttttagtccatgtaa |
14393071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #191
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 279 - 340
Target Start/End: Original strand, 19831505 - 19831566
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||| |||||||||||||| ||| ||||||||||| || ||||||||||||| ||||||| |
|
|
| T |
19831505 |
taaggttaaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctgtaa |
19831566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #192
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 343
Target Start/End: Original strand, 38231431 - 38231492
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||| || ||||| |||||||||||||||||| |
|
|
| T |
38231431 |
ggctaaaatatgattttgatccctgcaaatataccttgttttgattttagtccctgtaattt |
38231492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #193
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 281 - 330
Target Start/End: Original strand, 45442315 - 45442364
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
330 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||| ||||| ||||| |
|
|
| T |
45442315 |
aggctaaaatatggttttagtctctgcaaatatgtctcgttttgatttta |
45442364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #194
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 335
Target Start/End: Original strand, 1138055 - 1138095
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccc |
335 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
1138055 |
ttttggtccctgcaaatatgtctcgttttggttttggtccc |
1138095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #195
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 10665296 - 10665236
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| ||||| ||| ||||||||||| || ||||||||||||| ||||||| |
|
|
| T |
10665296 |
aaggctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagttcctgtaa |
10665236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #196
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 285 - 333
Target Start/End: Complemental strand, 17912808 - 17912760
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
|||||||||||||| || |||||||||||| ||| |||||||||||||| |
|
|
| T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtc |
17912760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #197
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 281 - 333
Target Start/End: Original strand, 26709695 - 26709747
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
||||||||||||| |||| || |||||||||||||||| ||||||| |||||| |
|
|
| T |
26709695 |
aggctaaaatatgattttagttcctgcaaatatgtctcgttttggtcttagtc |
26709747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #198
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 284 - 332
Target Start/End: Complemental strand, 36622582 - 36622534
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
||||||||||||||| ||||||||||||||| || ||||||||||||| |
|
|
| T |
36622582 |
ctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
36622534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #199
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 39367762 - 39367702
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| ||| |||||| ||||||| | ||||||||||||||| |||||| |
|
|
| T |
39367762 |
aaggctaaaatatggtcttgatccctgtaaatatgctttattttggttttagtctctgtaa |
39367702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #200
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 282 - 341
Target Start/End: Original strand, 11788052 - 11788111
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaat |
341 |
Q |
| |
|
|||||||||||| | ||| || ||||||| ||||||| |||| ||||||||||||||||| |
|
|
| T |
11788052 |
ggctaaaatatgatgttgatctctgcaaaaatgtctcgttttcgttttagtccctgtaat |
11788111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #201
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 280 - 323
Target Start/End: Complemental strand, 32691637 - 32691594
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcatttt |
323 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||| |||| |
|
|
| T |
32691637 |
aaggctaaaacatggttttagtccctgcaaatatgtctcgtttt |
32691594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #202
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 285 - 336
Target Start/End: Original strand, 43710384 - 43710435
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||| |||| |||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
43710384 |
taaaatataattttagtcccttcaaatatgtctcgttttggttttagtccct |
43710435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #203
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 280 - 333
Target Start/End: Original strand, 1295180 - 1295234
Alignment:
| Q |
280 |
aaggctaaa-atatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
||||||||| ||||| ||||||||| || ||||||||||| |||||||||||||| |
|
|
| T |
1295180 |
aaggctaaatatatgattttggtccatgtaaatatgtctcgttttggttttagtc |
1295234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #204
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 278 - 328
Target Start/End: Complemental strand, 1696459 - 1696409
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttt |
328 |
Q |
| |
|
|||||| ||||||||| |||| |||||| |||||||||||| ||||||||| |
|
|
| T |
1696459 |
ataaggttaaaatatgattttcgtcccttcaaatatgtctcgttttggttt |
1696409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #205
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 329
Target Start/End: Original strand, 3832344 - 3832378
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
3832344 |
ttttagtccctgcaaatatgtctcattttggtttt |
3832378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #206
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 4042817 - 4042775
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||| ||||||| |
|
|
| T |
4042817 |
ttttggtccctacaaatatgcctcattttggttttggtccctg |
4042775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #207
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 7121308 - 7121251
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| || |||| |||||||| ||||||| |||||||||| ||||| |
|
|
| T |
7121308 |
ggctaaaatatggttttagt-cctgtaaatatgtttcattttagttttagtccttgtaa |
7121251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #208
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 10671703 - 10671745
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
10671703 |
ttttggtccctgcaaatatgcttcattttggttttggtccctg |
10671745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #209
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 329
Target Start/End: Original strand, 18113162 - 18113196
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
18113162 |
ttttggtccctgcaaatatgcctcattttggtttt |
18113196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #210
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 279 - 313
Target Start/End: Complemental strand, 25979313 - 25979279
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25979313 |
taaggctaaaatatgtttttggtccctgcaaatat |
25979279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #211
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 329
Target Start/End: Original strand, 34317871 - 34317905
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
34317871 |
ttttggtccctgcaaatatgcctcattttggtttt |
34317905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #212
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 285 - 343
Target Start/End: Complemental strand, 35686335 - 35686277
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||| |||||| ||||||| || ||||||||||||| ||||||||| |
|
|
| T |
35686335 |
taaaatatggttttgatccctgtaaatatgcttcgttttggttttagtttctgtaattt |
35686277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #213
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 37228795 - 37228837
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||| ||||||| |
|
|
| T |
37228795 |
ttttggtccctgcaaatgtgtctcgttttggttttggtccctg |
37228837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #214
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 37911047 - 37911005
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||| ||||||| |
|
|
| T |
37911047 |
ttttggtccatgcaaatatgcctcattttggttttggtccctg |
37911005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #215
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 298 - 340
Target Start/End: Complemental strand, 41594320 - 41594278
Alignment:
| Q |
298 |
tggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
41594320 |
tggtccctgcaaatatctgacattttggttttagtccctgtaa |
41594278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #216
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 43672005 - 43672047
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| ||||||| |
|
|
| T |
43672005 |
ttttggtccctgcaaatatgtttcgttttggttttcgtccctg |
43672047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #217
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 280 - 313
Target Start/End: Original strand, 1777467 - 1777500
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
1777467 |
aaggctaaaatatgtttttggtccctgcaaatat |
1777500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #218
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 334
Target Start/End: Original strand, 19603737 - 19603790
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||| ||||||| |||||| |||| |
|
|
| T |
19603737 |
aggcttaaatatgtttttggtccctgcaaatataactcatttgggttttggtcc |
19603790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #219
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 314
Target Start/End: Original strand, 23861751 - 23861784
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatg |
314 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
23861751 |
aggctaaaatatgtttttggtccctgcaaatatg |
23861784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #220
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 300 - 340
Target Start/End: Complemental strand, 2395524 - 2395484
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
2395524 |
gtccctgcaaatatctgacattttggttttagtccctgtaa |
2395484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #221
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 313
Target Start/End: Complemental strand, 2412488 - 2412456
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
2412488 |
aggctaaaatatgtttttggtccctgcaaatat |
2412456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #222
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 300 - 340
Target Start/End: Original strand, 18369029 - 18369069
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
18369029 |
gtccctgcaaatatctgacattttggttttagtccctgtaa |
18369069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #223
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 313
Target Start/End: Original strand, 25977869 - 25977901
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
25977869 |
aggctaaaatatgtttttggtccctgcaaatat |
25977901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #224
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 300 - 340
Target Start/End: Original strand, 30432612 - 30432652
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
30432612 |
gtccctgcaaatatctgacattttggttttagtccctgtaa |
30432652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #225
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 30432982 - 30432922
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||| |||||||| ||||||| |||||||| | ||||||||||||||||||||||| |
|
|
| T |
30432982 |
aaggcttaaatatggaaatggtcccggcaaatatctgacattttggttttagtccctgtaa |
30432922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #226
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 283 - 339
Target Start/End: Original strand, 34963796 - 34963852
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
339 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| | ||||| |||||||| ||||| |
|
|
| T |
34963796 |
gctaaaatatggttttgatccctgctaatatgttttgttttgattttagtctctgta |
34963852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #227
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 276 - 340
Target Start/End: Complemental strand, 38732139 - 38732075
Alignment:
| Q |
276 |
ttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| ||| |||||| || |||| ||||| ||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
38732139 |
ttattaggttaaaatttgattttagtcccagcaaatatggctcgttttggttttaatccctgtaa |
38732075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 60; Significance: 1e-25; HSPs: 262)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 280 - 343
Target Start/End: Complemental strand, 7867359 - 7867296
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7867359 |
aaggctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctgtaattt |
7867296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 278 - 340
Target Start/End: Complemental strand, 12360972 - 12360910
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12360972 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
12360910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 280 - 341
Target Start/End: Original strand, 33234544 - 33234605
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaat |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33234544 |
aaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaat |
33234605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 3247196 - 3247256
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3247196 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
3247256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 19720710 - 19720770
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19720710 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
19720770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 8140433 - 8140492
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8140433 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
8140492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 39747836 - 39747777
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39747836 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
39747777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 42482978 - 42483037
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42482978 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtctctgtaa |
42483037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 284 - 342
Target Start/End: Original strand, 4789310 - 4789368
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaatt |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4789310 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaatt |
4789368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 10631164 - 10631222
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10631164 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
10631222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 16026939 - 16026877
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
16026939 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgcaattt |
16026877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 16060885 - 16060827
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16060885 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
16060827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 28507459 - 28507397
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
28507459 |
aggctaaaatattgttttggtccctgcaaatatgtctcattttagttttagtccctgtaattt |
28507397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 15526364 - 15526307
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15526364 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
15526307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 30322927 - 30322984
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
30322927 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
30322984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 33000671 - 33000614
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
33000671 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
33000614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 6567498 - 6567438
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6567498 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
6567438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 24507845 - 24507785
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
24507845 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
24507785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 33045692 - 33045632
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
33045692 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
33045632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 277 - 337
Target Start/End: Original strand, 35056525 - 35056585
Alignment:
| Q |
277 |
tataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35056525 |
tatatggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35056585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 45380271 - 45380327
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45380271 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
45380327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 336
Target Start/End: Complemental strand, 10887599 - 10887544
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10887599 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
10887544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 14007488 - 14007547
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14007488 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
14007547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 280 - 343
Target Start/End: Original strand, 18079396 - 18079459
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18079396 |
aaggctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtccctgtaattt |
18079459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 24977778 - 24977833
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24977778 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
24977833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 40718110 - 40718165
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40718110 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
40718165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 50799129 - 50799188
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
50799129 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
50799188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 12322970 - 12322912
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
12322970 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctgtaa |
12322912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 278 - 340
Target Start/End: Original strand, 29072493 - 29072555
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
29072493 |
ataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
29072555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 38151212 - 38151154
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
38151212 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
38151154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 41738796 - 41738854
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
41738796 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagtccctgtaa |
41738854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 10631530 - 10631473
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
10631530 |
aaggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
10631473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 281 - 342
Target Start/End: Original strand, 12360602 - 12360663
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaatt |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| ||||||| |||||||||| |
|
|
| T |
12360602 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagcccctgtaatt |
12360663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 281 - 338
Target Start/End: Original strand, 21391095 - 21391152
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21391095 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgt |
21391152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 24654169 - 24654112
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
24654169 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctg |
24654112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 38150846 - 38150903
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38150846 |
aaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
38150903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 38164297 - 38164240
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
38164297 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38164240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 44157696 - 44157753
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
44157753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 45290455 - 45290512
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45290455 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
45290512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 47819598 - 47819541
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
47819598 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 10887232 - 10887288
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
10887232 |
aggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
10887288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 13260322 - 13260266
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13260322 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
13260266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 283 - 343
Target Start/End: Original strand, 15058419 - 15058479
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||||| |||||||| |
|
|
| T |
15058419 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccttgtaattt |
15058479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 15211509 - 15211569
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||| |
|
|
| T |
15211509 |
aaggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtctctgtaa |
15211569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 26207280 - 26207336
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26207280 |
ctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgtaa |
26207336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 283 - 343
Target Start/End: Original strand, 32420099 - 32420159
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
32420099 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgcaattt |
32420159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 32626527 - 32626587
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
32626527 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaa |
32626587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 34002942 - 34002882
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34002942 |
aaggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctgtaa |
34002882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 45368488 - 45368548
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
45368488 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
45368548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 47819231 - 47819287
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
47819231 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
47819287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 48609234 - 48609294
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48609234 |
aaggctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccctgtaa |
48609294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 279 - 334
Target Start/End: Original strand, 7350420 - 7350475
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7350420 |
taaggttaaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
7350475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 11822366 - 11822307
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
11822366 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctgtaa |
11822307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 13770488 - 13770547
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
13770488 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
13770547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 18302388 - 18302329
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
18302388 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
18302329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 336
Target Start/End: Original strand, 19622654 - 19622709
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19622654 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
19622709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 22919683 - 22919742
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
22919683 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
22919742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 24653802 - 24653857
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
24653802 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24653857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 26324584 - 26324643
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
26324584 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
26324643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 31060787 - 31060842
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31060787 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
31060842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 278 - 337
Target Start/End: Complemental strand, 31061155 - 31061096
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
31061155 |
ataaggctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtccctg |
31061096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 278 - 337
Target Start/End: Complemental strand, 32729053 - 32728994
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
32729053 |
ataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
32728994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 48609595 - 48609536
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
48609595 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcactgtaa |
48609536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 280 - 338
Target Start/End: Original strand, 1810925 - 1810983
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
1810925 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
1810983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 279 - 337
Target Start/End: Complemental strand, 8140802 - 8140744
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||| |||||||||||||||||| |
|
|
| T |
8140802 |
taaggctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtccctg |
8140744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 278 - 340
Target Start/End: Original strand, 12361007 - 12361069
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| || ||| ||||||||||||||||||||| |
|
|
| T |
12361007 |
ataaggctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctgtaa |
12361069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 25658014 - 25658072
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
25658014 |
ggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttaatccctgtaa |
25658072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 275 - 337
Target Start/End: Original strand, 26061949 - 26062011
Alignment:
| Q |
275 |
tttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
26061949 |
tttagaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26062011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 26191734 - 26191676
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
26191734 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
26191676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 26442563 - 26442621
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
26442563 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccatgtaa |
26442621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 274 - 340
Target Start/End: Complemental strand, 32454302 - 32454236
Alignment:
| Q |
274 |
atttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||| ||| |||||| |||||||||||||| |
|
|
| T |
32454302 |
atttattaggctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctgtaa |
32454236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 33000305 - 33000363
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
33000305 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgtaa |
33000363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 35308111 - 35308053
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
35308111 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
35308053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 279 - 337
Target Start/End: Original strand, 41881090 - 41881148
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
41881090 |
taaggctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctg |
41881148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 276 - 337
Target Start/End: Complemental strand, 990385 - 990324
Alignment:
| Q |
276 |
ttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
990385 |
ttattaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
990324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 3753214 - 3753271
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
3753214 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
3753271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 279 - 340
Target Start/End: Original strand, 18899836 - 18899897
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
18899836 |
taaggttaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaa |
18899897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 283 - 340
Target Start/End: Complemental strand, 18928141 - 18928084
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
18928141 |
gctaaaatatggttttggtcgctgcaaatatgtctcattttagttttagtcccggtaa |
18928084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 282 - 339
Target Start/End: Original strand, 20948755 - 20948812
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
339 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||| |||||||||||||||| |
|
|
| T |
20948755 |
ggctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtccctgta |
20948812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 27521577 - 27521634
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
27521577 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
27521634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 38163929 - 38163986
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
38163929 |
aaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38163986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 39303675 - 39303732
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
39303675 |
gctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccctgtaa |
39303732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 281 - 330
Target Start/End: Complemental strand, 45638895 - 45638846
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45638895 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45638846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 285 - 337
Target Start/End: Complemental strand, 3247559 - 3247507
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
3247559 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3247507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 3679624 - 3679684
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
3679624 |
aaggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaa |
3679684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 11822002 - 11822062
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
11822002 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
11822062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 15516581 - 15516637
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
15516581 |
aggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccctg |
15516637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 18473271 - 18473327
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
18473271 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18473327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 336
Target Start/End: Complemental strand, 18473597 - 18473541
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
18473597 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
18473541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 285 - 341
Target Start/End: Complemental strand, 18900130 - 18900074
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaat |
341 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgtaat |
18900074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 26442901 - 26442841
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
26442901 |
aaggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctgtaa |
26442841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 30323294 - 30323238
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
30323294 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
30323238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 336
Target Start/End: Original strand, 33379886 - 33379942
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
33379886 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
33379942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 35056895 - 35056839
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
35056895 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
35056839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 35307713 - 35307773
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
35307713 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
35307773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 41358368 - 41358424
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
41358368 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41358424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 41358664 - 41358608
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
41358664 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
41358608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 336
Target Start/End: Original strand, 49073689 - 49073745
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||| |
|
|
| T |
49073689 |
aaggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttaatccct |
49073745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 278 - 337
Target Start/End: Original strand, 990084 - 990143
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
990084 |
ataaggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
990143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 4565337 - 4565278
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
4565337 |
aggctaaaatatggttctggtccctgcaaatatgtctcgttttaattttagtccctgtaa |
4565278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 7001897 - 7001842
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
7001897 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7001842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 7867128 - 7867187
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
7867128 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgtaa |
7867187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 280 - 343
Target Start/End: Original strand, 8364614 - 8364677
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||| || |||||||||||||| ||||||||| |
|
|
| T |
8364614 |
aaggttaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtcactgtaattt |
8364677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 13259987 - 13260046
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
13259987 |
aggctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccctgtaa |
13260046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 278 - 337
Target Start/End: Complemental strand, 19623021 - 19622962
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
19623021 |
ataaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
19622962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 21383103 - 21383162
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| |||| |||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
21383103 |
aggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctgtaa |
21383162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 24507479 - 24507534
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
24507479 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
24507534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 33045354 - 33045413
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
33045354 |
aggctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtccctgtaa |
33045413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 285 - 340
Target Start/End: Original strand, 34808200 - 34808255
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
34808200 |
taaaatatggttttagtcccttcaaatatgtctcgttttggttttagtccctgtaa |
34808255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 38136981 - 38136926
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
38136981 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
38136926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 45380636 - 45380581
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
45380636 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
45380581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 45638580 - 45638635
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
45638580 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
45638635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 285 - 340
Target Start/End: Complemental strand, 46184051 - 46183996
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
46184051 |
taaaatatagttttggtccctgtaaatatgtctcattttggttttcgtccctgtaa |
46183996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 46868577 - 46868522
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46868577 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
46868522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 50429210 - 50429151
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
50429210 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
50429151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 280 - 338
Target Start/End: Complemental strand, 3753574 - 3753516
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||| ||| ||||||||||||||||||| |
|
|
| T |
3753574 |
aaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgt |
3753516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 278 - 340
Target Start/End: Complemental strand, 4360630 - 4360568
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| || |||||||| |||||||| |
|
|
| T |
4360630 |
ataaggctaaaatatggttttagtccctgcaaatatgtctcgttggggttttagcccctgtaa |
4360568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 284 - 330
Target Start/End: Complemental strand, 17130081 - 17130035
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17130081 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17130035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 283 - 341
Target Start/End: Complemental strand, 19198948 - 19198890
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaat |
341 |
Q |
| |
|
||||||||||||||||| || ||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
19198948 |
gctaaaatatggttttgatctctgcaaatatgcctcattttgcttttagtccctgtaat |
19198890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 29072862 - 29072804
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
29072862 |
ggctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctgtaa |
29072804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 279 - 337
Target Start/End: Original strand, 31258336 - 31258394
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
31258336 |
taaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
31258394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 33234912 - 33234854
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
33234912 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttagtccctgtaa |
33234854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 279 - 337
Target Start/End: Original strand, 39747471 - 39747528
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
39747471 |
taaggctaaaatatggttttggtcc-tgcaaatacgtctcgttttggttttagtccctg |
39747528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 278 - 336
Target Start/End: Original strand, 44641074 - 44641132
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
44641074 |
ataaagctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
44641132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 44641432 - 44641374
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
44641432 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
44641374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 48956066 - 48956008
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
48956066 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaa |
48956008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 52254479 - 52254421
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
52254479 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaa |
52254421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 282 - 343
Target Start/End: Original strand, 12322604 - 12322665
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || ||||| ||||||||| |||||||| |
|
|
| T |
12322604 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttgattttagtccttgtaattt |
12322665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 282 - 343
Target Start/End: Original strand, 15466132 - 15466193
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||| | | ||||| |||||||||||||||||||||||||||| |
|
|
| T |
15466132 |
ggctaaaatatggttttggtccttacggatatgcctcattttggttttagtccctgtaattt |
15466193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 282 - 331
Target Start/End: Complemental strand, 22953556 - 22953507
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttag |
331 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
22953556 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttag |
22953507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 26062260 - 26062203
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||| |||||||||||||| ||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
26062260 |
aaggttaaaatatggttttagtccctgtaaatatgtctcattttggttttagttcctg |
26062203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 35005442 - 35005499
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
35005442 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35005499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 281 - 334
Target Start/End: Complemental strand, 35005745 - 35005692
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
35005745 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
35005692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 5058994 - 5058934
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
5058994 |
aaggttaaaatatggttttggtccctggaaatatgcctcgttttgattttagtccctgtaa |
5058934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 8364917 - 8364861
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||| |||||||||| ||||||| |
|
|
| T |
8364917 |
aggctaaaatatagttttggtccccgcaaatatgtctcgttttggttttcgtccctg |
8364861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 332
Target Start/End: Complemental strand, 15058768 - 15058716
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
15058768 |
aaggctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagt |
15058716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 16060594 - 16060653
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||| |||||||||||||| |||||| |
|
|
| T |
16060594 |
aaggctaaaatatggttttggtccct-caaatatgcctcgttttggttttagtcactgtaa |
16060653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 17129691 - 17129747
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| | |||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
17129691 |
ctaaaatatggttttgattcctgcaaatatgcctcgttttggttttagtccctgtaa |
17129747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 285 - 337
Target Start/End: Complemental strand, 19721071 - 19721019
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
19721019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 281 - 333
Target Start/End: Original strand, 22674202 - 22674254
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||| |||||||||||||| |
|
|
| T |
22674202 |
aggctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagtc |
22674254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 336
Target Start/End: Complemental strand, 29688430 - 29688374
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
29688430 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccct |
29688374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 278 - 334
Target Start/End: Original strand, 39025105 - 39025161
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| ||||| |||| |||| |
|
|
| T |
39025105 |
ataaggttaaaatatggttttggtccctgcaaatatgtctcgttttgattttcgtcc |
39025161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 336
Target Start/End: Complemental strand, 44158044 - 44157988
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || ||||||||||||||||| |
|
|
| T |
44158044 |
aaggctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagtccct |
44157988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 45290821 - 45290765
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| ||| |||||||||||||||||| |
|
|
| T |
45290821 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
45290765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 46183686 - 46183742
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||||||| |||| |
|
|
| T |
46183686 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccccgtaa |
46183742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 52254181 - 52254241
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
52254181 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccttgtaa |
52254241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 278 - 333
Target Start/End: Original strand, 16083043 - 16083098
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||| |||| ||||||||| |
|
|
| T |
16083043 |
ataaggctaaaatatggttttagtccccgcaaatatgtctcgtttttgttttagtc |
16083098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 24649350 - 24649405
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||| ||||| |
|
|
| T |
24649350 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagcccctg |
24649405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 24649661 - 24649602
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| ||||||||||||| |||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
24649661 |
aggccaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaa |
24649602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 324
Target Start/End: Original strand, 36912852 - 36912895
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttg |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36912852 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
36912895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 37545628 - 37545683
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||| |||||||||||||||||| |
|
|
| T |
37545628 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg |
37545683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 50428872 - 50428931
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
50428872 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttgcttttaatccctgtaa |
50428931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 3247489 - 3247447
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3247489 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
3247447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 16026865 - 16026823
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16026865 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
16026823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 280 - 338
Target Start/End: Original strand, 17984331 - 17984389
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||| |||| |
|
|
| T |
17984331 |
aaggctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagtctctgt |
17984389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 19721001 - 19720959
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19721001 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
19720959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 24507552 - 24507594
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24507552 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
24507594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 26191359 - 26191417
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || ||||||||||||||| ||||| |
|
|
| T |
26191359 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccttgtaa |
26191417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 26324948 - 26324886
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||| |||| |||| |||||||||| ||| |||||||||||||| ||||||||| |
|
|
| T |
26324948 |
aggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagtctctgtaattt |
26324886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 30323220 - 30323178
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30323220 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
30323178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 281 - 343
Target Start/End: Original strand, 30962415 - 30962477
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
30962415 |
aggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctgcaattt |
30962477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 31061078 - 31061036
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31061078 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
31061036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 33000596 - 33000554
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33000596 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
33000554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 35056821 - 35056779
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35056821 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
35056779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 38136908 - 38136866
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38136908 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
38136866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 38150921 - 38150963
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38150921 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
38150963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 38164004 - 38164046
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38164004 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
38164046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 336
Target Start/End: Complemental strand, 39025381 - 39025328
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||| ||||||||||||||||| |
|
|
| T |
39025381 |
ggctaaaatatggttttggtccctgcaaa-atgcctcgttttggttttagtccct |
39025328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 40718401 - 40718359
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40718401 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
40718359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 45380345 - 45380387
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45380345 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
45380387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 45638653 - 45638695
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45638653 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
45638695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 47819305 - 47819347
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47819305 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
47819347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 287 - 340
Target Start/End: Original strand, 2939934 - 2939987
Alignment:
| Q |
287 |
aaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctgtaa |
2939987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 4323829 - 4323886
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||| |||||||| |||||| |
|
|
| T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtctctgtaa |
4323886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 287 - 340
Target Start/End: Complemental strand, 4789639 - 4789586
Alignment:
| Q |
287 |
aaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
4789639 |
aaatttggttttggtccctgcaaatatgcatcattttggttttggtccctgtaa |
4789586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 282 - 343
Target Start/End: Complemental strand, 15211858 - 15211797
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||| ||||||||| | |||||| ||||| |
|
|
| T |
15211858 |
ggctaaaatatggttttggtccttgcaaatatgcctcgttttggtttcaatccctgcaattt |
15211797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 336
Target Start/End: Original strand, 24977852 - 24977893
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24977852 |
ttttggtccctgcaaatatgtctcattttggttttggtccct |
24977893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 281 - 334
Target Start/End: Original strand, 33067347 - 33067400
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||| |||||||||| |||| |
|
|
| T |
33067347 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttggtcc |
33067400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 280 - 329
Target Start/End: Original strand, 34002633 - 34002682
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
34002633 |
aaggctaaagtatgattttggtccctgcaaatatgtctcgttttggtttt |
34002682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 41739121 - 41739065
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
41739121 |
aggctaaaatatggttttagtccctgcaaatat---tcgttttggttttagtccctgtaa |
41739065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 282 - 338
Target Start/End: Complemental strand, 3679986 - 3679930
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||| ||||||||||||| |
|
|
| T |
3679986 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctgt |
3679930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 285 - 341
Target Start/End: Complemental strand, 7350733 - 7350677
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaat |
341 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||| ||||||||||||||| |||||| |
|
|
| T |
7350733 |
taaaatatggttttggtcactgcaaatatacctcgttttggttttagtccttgtaat |
7350677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 336
Target Start/End: Original strand, 16026571 - 16026627
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
16026571 |
aaggctaaaatataattttggtccctgcaaatatccctcgttttggttttagtccct |
16026627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 300 - 340
Target Start/End: Original strand, 18302071 - 18302111
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18302071 |
gtccctgcaaatatgtctcgttttggttttagtccctgtaa |
18302111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 24978124 - 24978064
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
24978124 |
aaggctaaaatatagttttggtcctggcaaatatgcctcgttttggttttagttcctgtaa |
24978064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 29579322 - 29579378
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| |||| |||||||||| |||||||| ||||||||||||||| |
|
|
| T |
29579322 |
ctaaaatatggtttttgtccttgcaaatatgcctcattttaattttagtccctgtaa |
29579378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 285 - 337
Target Start/End: Complemental strand, 31258699 - 31258647
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| |||| ||||||||||||| |
|
|
| T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccctg |
31258647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 31404723 - 31404667
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||| || | ||||||||||||| |
|
|
| T |
31404723 |
aggctaaaatatggttttggtccctacaaacatgtctcgttgttgttttagtccctg |
31404667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 281 - 317
Target Start/End: Complemental strand, 32035789 - 32035753
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtct |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32035789 |
aggctaaaatatggttttggtccctgcaaatatgtct |
32035753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 278 - 334
Target Start/End: Original strand, 37624742 - 37624798
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||| ||| |||||||||| |||| |
|
|
| T |
37624742 |
ataaggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttggtcc |
37624798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 283 - 343
Target Start/End: Complemental strand, 37625026 - 37624966
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||| || |||||||| ||||| ||||||||| |
|
|
| T |
37625026 |
gctaaaatatggttttagtccctgtaaatatgtatcgttttggttgtagtctctgtaattt |
37624966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 274 - 314
Target Start/End: Complemental strand, 42483279 - 42483239
Alignment:
| Q |
274 |
atttataaggctaaaatatggttttggtccctgcaaatatg |
314 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42483279 |
atttttaaggctaaaatatggttttggtccctgcaaatatg |
42483239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 284 - 340
Target Start/End: Complemental strand, 45368847 - 45368791
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||| |||| ||| ||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
45368847 |
ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtccctgtaa |
45368791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 46868224 - 46868284
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||| |||| |||| ||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
46868224 |
aaggctaaattatgattttagtccctgcaaatatgcttcattttggttttagtctctgtaa |
46868284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 284 - 340
Target Start/End: Complemental strand, 48730615 - 48730559
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||| |||| |||||||||| ||||| |
|
|
| T |
48730615 |
ctaaaatatggttttggtccttgcaaatatgcctcgtttttgttttagtccttgtaa |
48730559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 281 - 333
Target Start/End: Original strand, 48955713 - 48955765
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
48955713 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
48955765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 285 - 340
Target Start/End: Original strand, 4617091 - 4617146
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||| |||||||| || |||| ||||||||| |||||| |
|
|
| T |
4617091 |
taaaatatggttttggtccctgaaaatatgtttcgttttagttttagtctctgtaa |
4617146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 7819104 - 7819045
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| ||| |||||||||||||| |||||| |
|
|
| T |
7819104 |
aggctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagtctctgtaa |
7819045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 12158690 - 12158745
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
12158690 |
ggctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtccctg |
12158745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 285 - 340
Target Start/End: Complemental strand, 15335292 - 15335237
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
15335237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #201
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 282 - 333
Target Start/End: Complemental strand, 17984701 - 17984650
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
17984701 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
17984650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #202
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 21383429 - 21383370
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| ||||| ||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
21383429 |
aggctaaaatatagttttaatccttgcaaatatgcctcattttgattttagtccctgtaa |
21383370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #203
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 22919978 - 22919919
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| ||| |||| |||||||||| ||||| |
|
|
| T |
22919978 |
aggctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagtccttgtaa |
22919919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #204
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 40718474 - 40718419
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||| |||||||||||| |
|
|
| T |
40718474 |
ggctaaaatatggttttggtccctgcaaatatgcatagttttgattttagtccctg |
40718419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #205
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 4617396 - 4617334
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||| ||||||| || ||||||||| || |||||||||||||| ||||||||| |
|
|
| T |
4617396 |
aggctaaaatatgattttggttccaacaaatatgtttcgttttggttttagtctctgtaattt |
4617334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #206
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 10631455 - 10631413
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
10631455 |
ttttggtctctgcaaatatgtctcattttggttttggtccctg |
10631413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #207
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 10887306 - 10887348
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
10887306 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
10887348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #208
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 271 - 313
Target Start/End: Complemental strand, 17977629 - 17977587
Alignment:
| Q |
271 |
taaatttataaggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17977629 |
taaattaataaggcttaaatatggttttggtccctgcaaatat |
17977587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #209
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 284 - 334
Target Start/End: Original strand, 22953258 - 22953308
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
||||||||| ||||| |||| ||||||||||||||||||||| |||||||| |
|
|
| T |
22953258 |
ctaaaatatagttttagtccatgcaaatatgtctcattttggatttagtcc |
22953308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #210
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 282 - 332
Target Start/End: Complemental strand, 24510308 - 24510258
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||| |||||||| |
|
|
| T |
24510308 |
ggctaaaatatggttttggtccctgcaaatatggttcgttttagttttagt |
24510258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #211
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 329
Target Start/End: Complemental strand, 24654094 - 24654060
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
24654094 |
ttttggtccctgcaaatatgtctcattttggtttt |
24654060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #212
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 26324874 - 26324832
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
26324874 |
ttttggtccctgcaaatatgtctcgttttggttttcgtccctg |
26324832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #213
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 288 - 334
Target Start/End: Original strand, 32035442 - 32035488
Alignment:
| Q |
288 |
aatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||| || ||||||||||||||| ||||||||||||||| |
|
|
| T |
32035442 |
aatatggttttgatctctgcaaatatgtctcgttttggttttagtcc |
32035488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #214
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 46183757 - 46183799
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
46183757 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
46183799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #215
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 281 - 339
Target Start/End: Complemental strand, 49923819 - 49923761
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
339 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||| || ||||| |||||||||||||| |
|
|
| T |
49923819 |
aggctaaaatatgattttggtctctgcaaatatgcttcgttttgattttagtccctgta |
49923761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #216
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 283 - 332
Target Start/End: Original strand, 7818783 - 7818832
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
7818783 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
7818832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #217
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 283 - 340
Target Start/End: Complemental strand, 33067729 - 33067672
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||||||| ||||||||||| | ||||||| |
|
|
| T |
33067729 |
gctaaaatatcgttttagtccttgcaaatatgtctcgttttggttttaattcctgtaa |
33067672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #218
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 343
Target Start/End: Complemental strand, 34383244 - 34383183
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||| |||| || |||| |||||||| | |||||||||||||||||||||||| |
|
|
| T |
34383244 |
ggctaaaatatgattttagttcctgtaaatatgtattgttttggttttagtccctgtaattt |
34383183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #219
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 343
Target Start/End: Original strand, 5058736 - 5058795
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||| | |||| ||||||||||||||||||| |
|
|
| T |
5058736 |
gctaaaatatgattttggtccatgcaaatatgt-tagttttagttttagtccctgtaattt |
5058795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #220
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 324
Target Start/End: Complemental strand, 18079662 - 18079618
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttg |
324 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||| |
|
|
| T |
18079662 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #221
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 303 - 343
Target Start/End: Original strand, 24509963 - 24510003
Alignment:
| Q |
303 |
cctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
24509963 |
cctgcaaatatgtttcgttttggttttagtccctgtaattt |
24510003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #222
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 284 - 340
Target Start/End: Complemental strand, 25658299 - 25658243
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||| ||||| |||||||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
25658299 |
ctaaaatattcttttgatccctgcaaatatgcctcgttttgattttagtccctgtaa |
25658243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #223
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 285 - 333
Target Start/End: Complemental strand, 32906237 - 32906189
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
32906237 |
taaaatatgattttggtccttgcaaatatgtctcgttttgattttagtc |
32906189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #224
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 277 - 313
Target Start/End: Complemental strand, 35911952 - 35911916
Alignment:
| Q |
277 |
tataaggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35911952 |
tataaggctaaaatatgcttttggtccctgcaaatat |
35911916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #225
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 274 - 336
Target Start/End: Original strand, 292853 - 292913
Alignment:
| Q |
274 |
atttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||| ||||||||||| |||||| ||||||||||||||| ||| ||||| ||||||||||| |
|
|
| T |
292853 |
atttaaaaggctaaaat--ggttttagtccctgcaaatatgcctcgttttgcttttagtccct |
292913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #226
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 8140726 - 8140683
Alignment:
| Q |
295 |
ttttggtccctgcaaa-tatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
8140726 |
ttttggtccctgcaaaatatgtctcattttggttttggtccctg |
8140683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #227
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 26244546 - 26244605
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||| |||||||| |||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
26244546 |
aggcttaaatatggaaatggtccctgcaaatatctgacattttggttttagtccctgtaa |
26244605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #228
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 26699607 - 26699549
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| || |||| ||||||||| |||||| |
|
|
| T |
26699607 |
aggctaaaatatggttttggt-cctgcaaatatgcttcgtttttgttttagtctctgtaa |
26699549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #229
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 278 - 313
Target Start/End: Original strand, 27262904 - 27262939
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27262904 |
ataaggctaaaatatgtttttggtccctgcaaatat |
27262939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #230
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 278 - 313
Target Start/End: Original strand, 37395629 - 37395664
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37395629 |
ataaggctaaaatatgtttttggtccctgcaaatat |
37395664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #231
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 295 - 334
Target Start/End: Complemental strand, 44157969 - 44157930
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
44157969 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
44157930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #232
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 15211783 - 15211741
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||| ||||||| |
|
|
| T |
15211783 |
ttttggtccttgcaaatatgtctcgttttggttttggtccctg |
15211741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #233
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 16060668 - 16060710
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| ||||||| |
|
|
| T |
16060668 |
ttttggtccctgcaaatatgcctcattttgattttggtccctg |
16060710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #234
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 17130011 - 17129969
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||| ||||||| |
|
|
| T |
17130011 |
ttttggtccttgcaaatatgtctcgttttggttttggtccctg |
17129969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #235
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 329
Target Start/End: Complemental strand, 20949008 - 20948974
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
20949008 |
ttttggtccgtgcaaatatgtctcattttggtttt |
20948974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #236
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 280 - 338
Target Start/End: Complemental strand, 21391376 - 21391318
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
|||| |||||||||||||| ||||||| ||||||| ||| |||| ||||||||| |||| |
|
|
| T |
21391376 |
aaggttaaaatatggttttagtccctgtaaatatgcctcgttttagttttagtctctgt |
21391318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #237
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 30968143 - 30968086
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctc-attttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
30968143 |
aaggctaaaatatgacattggtccctgcaaatatg-ctcaattttggttttagtccctg |
30968086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #238
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 285 - 323
Target Start/End: Original strand, 31404429 - 31404467
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcatttt |
323 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
31404429 |
taaaatatgattttggtccctgcaaatatgtctcgtttt |
31404467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #239
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 49073980 - 49073938
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||| ||||||| |
|
|
| T |
49073980 |
ttttggtccttgcaaatatgcctcattttggttttggtccctg |
49073938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #240
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 280 - 314
Target Start/End: Original strand, 50164401 - 50164435
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatg |
314 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
50164401 |
aaggctaaaatatgcttttggtccctgcaaatatg |
50164435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #241
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 280 - 313
Target Start/End: Complemental strand, 9774949 - 9774916
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
9774949 |
aaggctaaaatatgcttttggtccctgcaaatat |
9774916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #242
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 287 - 340
Target Start/End: Complemental strand, 16083394 - 16083341
Alignment:
| Q |
287 |
aaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| |||||||||||||| ||| ||||| |||||||| |||||| |
|
|
| T |
16083394 |
aaatatggttttagtccctgcaaatatacctcgttttgattttagtctctgtaa |
16083341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #243
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 280 - 313
Target Start/End: Complemental strand, 20723749 - 20723716
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
20723749 |
aaggctaaaatatgtttttggtccctgcaaatat |
20723716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #244
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 279 - 340
Target Start/End: Original strand, 20756016 - 20756077
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||| ||||||||| |||| ||| || ||||||||||| ||||||||||||||| ||||| |
|
|
| T |
20756016 |
taaggttaaaatatgattttaatccttgtaaatatgtctcgttttggttttagtccttgtaa |
20756077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #245
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 283 - 324
Target Start/End: Complemental strand, 26142671 - 26142630
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttg |
324 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
26142671 |
gctaaaatatggttttaatccctgcaaatatgcctcattttg |
26142630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #246
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 34382948 - 34383004
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||| ||||||||||||| |||||| |
|
|
| T |
34382948 |
gctaaaatatggttttagtccctgcaaatatacctc-gtttggttttagtctctgtaa |
34383004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #247
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 314
Target Start/End: Complemental strand, 39163084 - 39163051
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatg |
314 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
39163084 |
aggctaaaatatgcttttggtccctgcaaatatg |
39163051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #248
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 4324168 - 4324108
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| ||||||||| |||| || | |||||||||||||| ||||||||||| ||| ||||| |
|
|
| T |
4324168 |
aaggttaaaatatgattttagttcatgcaaatatgtctcgttttggttttaatccttgtaa |
4324108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #249
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 300 - 340
Target Start/End: Original strand, 20061814 - 20061854
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
20061814 |
gtccctgcaaatatctgacattttggttttagtccctgtaa |
20061854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #250
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 282 - 314
Target Start/End: Original strand, 24609919 - 24609951
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatg |
314 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
24609919 |
ggctaaaatatgtttttggtccctgcaaatatg |
24609951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #251
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 298 - 334
Target Start/End: Complemental strand, 25658226 - 25658190
Alignment:
| Q |
298 |
tggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
25658226 |
tggtccctgcaaatatgcctcattttggttttggtcc |
25658190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #252
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 313
Target Start/End: Complemental strand, 27264276 - 27264244
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
27264276 |
aggctaaaatatgattttggtccctgcaaatat |
27264244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #253
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 300 - 340
Target Start/End: Complemental strand, 28032014 - 28031974
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
28032014 |
gtccctgcaaatatctgacattttggttttagtccctgtaa |
28031974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #254
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 308 - 340
Target Start/End: Original strand, 32453956 - 32453988
Alignment:
| Q |
308 |
aaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
32453956 |
aaatatgtctcgttttggttttagtccctgtaa |
32453988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #255
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 313
Target Start/End: Original strand, 35721100 - 35721132
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
35721100 |
aggctaaaatatgtttttggtccctgcaaatat |
35721132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #256
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 304 - 340
Target Start/End: Original strand, 37172268 - 37172304
Alignment:
| Q |
304 |
ctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||| |
|
|
| T |
37172268 |
ctgcaaatatctgtcattttggttttagtccctgtaa |
37172304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #257
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 295 - 335
Target Start/End: Original strand, 39747546 - 39747586
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccc |
335 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| ||||| |
|
|
| T |
39747546 |
ttttggtccctgcaaatatgccttattttggttttggtccc |
39747586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #258
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 313
Target Start/End: Complemental strand, 45979556 - 45979524
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
45979556 |
aggctaaaatatgtttttggtccctgcaaatat |
45979524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #259
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 46073884 - 46073940
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||| | |||| |||||||||||||| |
|
|
| T |
46073884 |
aggctaaaatatgcttttgatccctgcaaatatagcaaatttgggttttagtccctg |
46073940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #260
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 300 - 340
Target Start/End: Original strand, 50096149 - 50096189
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
50096149 |
gtccctgcaaatatctgacattttggttttagtccctgtaa |
50096189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #261
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 300 - 340
Target Start/End: Complemental strand, 50625131 - 50625091
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
50625131 |
gtccctgcaaatatctgacattttggttttagtccctgtaa |
50625091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #262
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 280 - 328
Target Start/End: Complemental strand, 51986576 - 51986528
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttt |
328 |
Q |
| |
|
|||| |||||||||||||| |||||| |||||||||| |||||| |||| |
|
|
| T |
51986576 |
aaggttaaaatatggtttttgtccctacaaatatgtcgcattttagttt |
51986528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 6e-25; HSPs: 232)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 41054237 - 41054175
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41054237 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaattt |
41054175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 14543708 - 14543768
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14543708 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccatgtaa |
14543768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 27458397 - 27458457
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27458397 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
27458457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 279 - 343
Target Start/End: Original strand, 46828941 - 46829005
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46828941 |
taaggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgtaattt |
46829005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 35838338 - 35838279
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35838338 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
35838279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 277 - 340
Target Start/End: Complemental strand, 45228923 - 45228860
Alignment:
| Q |
277 |
tataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
45228923 |
tataaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
45228860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 282 - 341
Target Start/End: Complemental strand, 46829312 - 46829253
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaat |
341 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46829312 |
ggctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtccctgtaat |
46829253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 278 - 340
Target Start/End: Original strand, 35837920 - 35837982
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
35837920 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaa |
35837982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 278 - 340
Target Start/End: Original strand, 41053838 - 41053900
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
41053838 |
ataaggctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctgtaa |
41053900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 8144293 - 8144350
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8144293 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8144350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 284 - 341
Target Start/End: Original strand, 17854151 - 17854208
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaat |
341 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17854151 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgtaat |
17854208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 23399978 - 23399921
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
23399978 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23399921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 25092158 - 25092215
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25092158 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25092215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 1614558 - 1614614
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1614558 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1614614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 1614906 - 1614846
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
1614906 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
1614846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 3975547 - 3975607
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
3975547 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
3975607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 5234206 - 5234146
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
5234206 |
aaggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaa |
5234146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 9659691 - 9659631
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
9659691 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
9659631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 25988384 - 25988440
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25988384 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25988440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 44344791 - 44344731
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44344791 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
44344731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 11767276 - 11767217
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11767276 |
aggctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtccctgtaa |
11767217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 285 - 340
Target Start/End: Complemental strand, 16941049 - 16940994
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16941049 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
16940994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 28262712 - 28262771
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
28262712 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctgtaa |
28262771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 39832905 - 39832964
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39832905 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
39832964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 46759657 - 46759716
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
46759657 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaa |
46759716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 16853589 - 16853531
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
16853589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
16853531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 19561450 - 19561392
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
19561450 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
19561392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 35210515 - 35210457
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35210515 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
35210457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 46759942 - 46759884
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46759942 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
46759884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 25092550 - 25092493
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
25092550 |
aaggctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtccctg |
25092493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 25988751 - 25988694
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
25988751 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25988694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 30223459 - 30223516
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
30223459 |
aaggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg |
30223516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 39439031 - 39438974
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
39439031 |
aaggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
39438974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 279 - 340
Target Start/End: Original strand, 44402957 - 44403018
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
44402957 |
taaggctaaaatatggttttagtccctgcaaatatgccccattttggttttagtccctgtaa |
44403018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 44568692 - 44568635
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44568692 |
aaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
44568635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 8144659 - 8144603
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
8144659 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8144603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 12894404 - 12894344
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
12894404 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
12894344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 19757746 - 19757806
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
19757746 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
19757806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 23399611 - 23399667
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
23399611 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23399667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 285 - 337
Target Start/End: Original strand, 23676135 - 23676187
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
23676135 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
23676187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 23676453 - 23676397
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
23676453 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
23676397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 26878072 - 26878016
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
26878072 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
26878016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 28911908 - 28911848
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
28911908 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
28911848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 29198302 - 29198358
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
29198302 |
aggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg |
29198358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 29198663 - 29198607
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
29198663 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29198607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 283 - 343
Target Start/End: Complemental strand, 37527421 - 37527361
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37527421 |
gctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtccctgtaattt |
37527361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 39520396 - 39520456
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
39520396 |
aaggctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctgtaa |
39520456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 44958508 - 44958448
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
44958508 |
aaggctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtccctgtaa |
44958448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 48192489 - 48192433
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
48192489 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 280 - 343
Target Start/End: Complemental strand, 2945847 - 2945784
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
2945847 |
aaggctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtccctgtaattt |
2945784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 5354767 - 5354826
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||| ||||||||||||||||||||| |
|
|
| T |
5354767 |
aggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgtaa |
5354826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 17999722 - 17999663
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
17999722 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
17999663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 278 - 337
Target Start/End: Original strand, 26877674 - 26877733
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||| |||||||||||||||||| |
|
|
| T |
26877674 |
ataaggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccctg |
26877733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 277 - 340
Target Start/End: Complemental strand, 30223800 - 30223737
Alignment:
| Q |
277 |
tataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
30223800 |
tataaggctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtccttgtaa |
30223737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 280 - 343
Target Start/End: Original strand, 31503418 - 31503481
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||| |||||||||||||||| ||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31503418 |
aaggttaaaatatggttttggcccctgtaaatatgtctctttttggttttagtccctgtaattt |
31503481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 35104296 - 35104237
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
35104296 |
aggctcaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
35104237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 35470281 - 35470222
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35470281 |
aggctaaaatttggttttgatccctgcaaatatgcctcattttggttttagtccctgtaa |
35470222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 277 - 340
Target Start/End: Complemental strand, 39520735 - 39520672
Alignment:
| Q |
277 |
tataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
39520735 |
tataaggttaaaatatggttttggtccttgcaaatatgtctcgttttgattttagtccctgtaa |
39520672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 278 - 337
Target Start/End: Original strand, 44568322 - 44568381
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
44568322 |
ataaggctaaaatatggttttggtccctgcaaatataactcgttttggttttagtccctg |
44568381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 1974009 - 1974067
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
1974009 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctgtaa |
1974067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 6892261 - 6892199
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||| ||||||||||||||||| |
|
|
| T |
6892261 |
aggctaaaatatggttttggtccctgcaaaaatgtcttgttttgggtttagtccctgtaattt |
6892199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 13769774 - 13769832
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
13769774 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
13769832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 25547490 - 25547432
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
25547490 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
25547432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 285 - 343
Target Start/End: Original strand, 34877777 - 34877835
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctttaattt |
34877835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 286 - 340
Target Start/End: Original strand, 37372441 - 37372495
Alignment:
| Q |
286 |
aaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
37372495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 281 - 334
Target Start/End: Complemental strand, 3975839 - 3975786
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
3975839 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
3975786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 5233806 - 5233863
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
5233806 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
5233863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 6108332 - 6108389
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
6108332 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
6108389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 271 - 340
Target Start/End: Complemental strand, 13770092 - 13770023
Alignment:
| Q |
271 |
taaatttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||| | | ||||||||||||| ||||||| |
|
|
| T |
13770092 |
taaatatataaggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcctgtaa |
13770023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 282 - 343
Target Start/End: Original strand, 28528905 - 28528966
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
28528905 |
ggctaaaatatggttttggttcctgtaaatatgtctcgtttgggttttagtccctgtaattt |
28528966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 35104076 - 35104133
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35104076 |
aaggctaaaatataattttggtccctgcaaatatgtctcgttttggttttagtccctg |
35104133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 44509056 - 44508999
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
44509056 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44508999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 48192255 - 48192312
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
48192255 |
aaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
48192312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 6509206 - 6509266
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||| |||||||||||||||| |
|
|
| T |
6509206 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctgtaa |
6509266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 6509472 - 6509412
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
6509472 |
aaggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaa |
6509412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 8555801 - 8555741
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
8555801 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgtaa |
8555741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 9659354 - 9659410
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
9659354 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
9659410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 16940760 - 16940820
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
16940760 |
aaggctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtccctgtaa |
16940820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 34878127 - 34878067
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||||||| || |||||| |
|
|
| T |
34878127 |
aaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttaatctctgtaa |
34878067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 37372906 - 37372846
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
37372906 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacctgtaa |
37372846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 37952671 - 37952727
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
37952671 |
ctaaaatatggttttagtccctgtaaatatgtcttattttggttttagtccctgtaa |
37952727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 295 - 343
Target Start/End: Complemental strand, 41054163 - 41054115
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41054163 |
ttttggtccctgcaaatatgcctcattttggttttagtccctgtaattt |
41054115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 45073643 - 45073583
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
45073643 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
45073583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 48852442 - 48852502
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||| |||||||||| ||||| |
|
|
| T |
48852442 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccttgtaa |
48852502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 48854072 - 48854012
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
48854072 |
aaggctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtccctgtaa |
48854012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 1006835 - 1006890
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
1006835 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
1006890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 3807863 - 3807922
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
3807863 |
aggctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagttcctgtaa |
3807922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 12932784 - 12932725
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
12932784 |
aggctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtccctgtaa |
12932725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 19783814 - 19783873
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
19783814 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
19783873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 20388273 - 20388332
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
20388273 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgtaa |
20388332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 23816669 - 23816728
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||| |||||| |
|
|
| T |
23816669 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtctctgtaa |
23816728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 27037593 - 27037648
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||| ||||||||||||| |
|
|
| T |
27037593 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
27037648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 28911576 - 28911635
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||| |||||||||||||||| |
|
|
| T |
28911576 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaa |
28911635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 277 - 340
Target Start/End: Original strand, 39719348 - 39719411
Alignment:
| Q |
277 |
tataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| ||||||||||||||||| |||||| |||||||| |||||||||||||||||| |||||| |
|
|
| T |
39719348 |
tatatggctaaaatatggttttagtccctacaaatatgcctcattttggttttagtctctgtaa |
39719411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 39719643 - 39719584
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||| |||||||||||||||| |
|
|
| T |
39719643 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtccctgtaa |
39719584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 44508720 - 44508775
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
44508720 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44508775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 332
Target Start/End: Complemental strand, 45021857 - 45021806
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
45021857 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
45021806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 5308323 - 5308381
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||| |||| |||||||||||||||| |
|
|
| T |
5308323 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctgtaa |
5308381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 10358368 - 10358310
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
10358368 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaa |
10358310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 17999465 - 17999523
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||| |||||||||| |
|
|
| T |
17999465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttcgtccctgtaa |
17999523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 336
Target Start/End: Complemental strand, 24717532 - 24717478
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||| ||||||||||||||||| |
|
|
| T |
24717532 |
ggctaaaatatggttttggtccctaccaatatgtctcgttttggttttagtccct |
24717478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 35469880 - 35469938
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || |||||||||||||| |||||| |
|
|
| T |
35469880 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtctctgtaa |
35469938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 39833236 - 39833178
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
39833236 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctgtaa |
39833178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 336
Target Start/End: Complemental strand, 44403249 - 44403195
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
44403249 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccct |
44403195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 285 - 343
Target Start/End: Original strand, 44841359 - 44841417
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
44841359 |
taaaatatggttttgatccctgcaaatatgcctcgttttgattttagtccctgtaattt |
44841417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 46304384 - 46304326
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
46304384 |
ggctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctgtaa |
46304326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 332
Target Start/End: Complemental strand, 48359075 - 48359025
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
48359075 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
48359025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 291 - 340
Target Start/End: Complemental strand, 1271590 - 1271541
Alignment:
| Q |
291 |
atggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
1271590 |
atggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
1271541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 6079810 - 6079867
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
6079810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaa |
6079867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 286 - 339
Target Start/End: Original strand, 6954862 - 6954915
Alignment:
| Q |
286 |
aaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
339 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||||||| ||||| |
|
|
| T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggttttagtctctgta |
6954915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 281 - 338
Target Start/End: Original strand, 22539929 - 22539986
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
22539929 |
aggctaaaatatggttttgatccctccaaatatgcctcattttggttttagttcctgt |
22539986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 279 - 343
Target Start/End: Complemental strand, 38186764 - 38186699
Alignment:
| Q |
279 |
taaggctaaaatatggtttt-ggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||| |||||||||||||| || |||||| |
|
|
| T |
38186764 |
taaggctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtctctataattt |
38186699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 489074 - 489014
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| |||| ||| ||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
489074 |
aaggctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtccctgtaa |
489014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 1559707 - 1559647
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||| ||||||||||||||| |
|
|
| T |
1559707 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccctgtaa |
1559647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 282 - 334
Target Start/End: Original strand, 6589021 - 6589073
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||| |||| |
|
|
| T |
6589021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtcc |
6589073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 6589276 - 6589216
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| || ||||||||||||||| ||||| |
|
|
| T |
6589276 |
aaggttaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccatgtaa |
6589216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 284 - 340
Target Start/End: Complemental strand, 6847117 - 6847061
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
| T |
6847117 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtctctgtaa |
6847061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 336
Target Start/End: Complemental strand, 21223750 - 21223694
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
21223750 |
aaggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
21223694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 281 - 333
Target Start/End: Complemental strand, 30709645 - 30709593
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
30709645 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtc |
30709593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 284 - 340
Target Start/End: Complemental strand, 32189388 - 32189332
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| ||| ||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
32189388 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaa |
32189332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 35015221 - 35015165
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
35015221 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35015165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 38186364 - 38186424
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||| ||||| |||||| |||||||| |
|
|
| T |
38186364 |
aaggttaaaatatggttttggtccctgcaaatatgcctcgttttgattttaggccctgtaa |
38186424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 281 - 333
Target Start/End: Original strand, 39438740 - 39438792
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
39438740 |
aggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
39438792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 283 - 343
Target Start/End: Original strand, 43300613 - 43300672
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
43300613 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagt-cctgtaattt |
43300672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 282 - 333
Target Start/End: Original strand, 7431951 - 7432002
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||| |
|
|
| T |
7431951 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
7432002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 10358000 - 10358059
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| | || ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
10358000 |
aggctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
10358059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 285 - 336
Target Start/End: Original strand, 11766920 - 11766971
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||| |||||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttcgtccct |
11766971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 18022705 - 18022646
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
18022705 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
18022646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 282 - 333
Target Start/End: Complemental strand, 18927091 - 18927040
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
18927091 |
ggctaaaatatagttttagtccctgcaaatatgtctcattttagttttagtc |
18927040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 19465981 - 19465923
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
19465981 |
aggctaaaatatggttttag-ccctgcaaatatgtctcgtttcggttttagtccctgtaa |
19465923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 21554754 - 21554695
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
21554754 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctgtaa |
21554695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 31310364 - 31310423
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| |||| |||||||||||||| |||| |||||||||||||| |||||| |
|
|
| T |
31310364 |
aggctaaaatatgattttagtccctgcaaatatttctcgttttggttttagtctctgtaa |
31310423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 285 - 340
Target Start/End: Complemental strand, 31503780 - 31503725
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||| |||||||| |||||| |
|
|
| T |
31503780 |
taaaatatggttttagtccctgcaaatatgtctcgttttgattttagtctctgtaa |
31503725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 45073313 - 45073372
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| | ||| ||||||||||| ||||||||| |
|
|
| T |
45073313 |
aggctaaaatatggttttagtccctgcaaataagcctcgttttggttttaatccctgtaa |
45073372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 332
Target Start/End: Original strand, 19561154 - 19561204
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
19561154 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
19561204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 23399685 - 23399727
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23399685 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
23399727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 23676205 - 23676247
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
23676205 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
23676247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 25092233 - 25092275
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25092233 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
25092275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 25988676 - 25988634
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25988676 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
25988634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 26877751 - 26877793
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26877751 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
26877793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 27037860 - 27037818
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27037860 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
27037818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 29198376 - 29198418
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29198376 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
29198418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 31732101 - 31732159
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||| ||||| ||||||||| |
|
|
| T |
31732101 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccctgtaa |
31732159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 281 - 339
Target Start/End: Original strand, 35665876 - 35665934
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
339 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
35665876 |
aggctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtccctgta |
35665934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 44568399 - 44568441
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44568399 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
44568441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 336
Target Start/End: Original strand, 1614632 - 1614673
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1614632 |
ttttggtccctgcaaatatgtctcattttggttttggtccct |
1614673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 14739006 - 14738949
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || ||||| |||||||||||| |
|
|
| T |
14739006 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg |
14738949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 283 - 332
Target Start/End: Original strand, 18022368 - 18022417
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||| ||||||||||||| |
|
|
| T |
18022368 |
gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagt |
18022417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 284 - 341
Target Start/End: Complemental strand, 28263069 - 28263012
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaat |
341 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| | ||||| |||||||||||||||| |
|
|
| T |
28263069 |
ctaaaatatggttttgatccctgcaaatatgtattgttttgattttagtccctgtaat |
28263012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 30352558 - 30352615
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||| ||| ||||||||| |||||||| |
|
|
| T |
30352558 |
aaggttaaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtccctg |
30352615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 281 - 338
Target Start/End: Original strand, 35210181 - 35210238
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
||||||||||||| ||||| |||| ||||||||| ||| ||||||||||||||||||| |
|
|
| T |
35210181 |
aggctaaaatatgattttgatcccggcaaatatgactcgttttggttttagtccctgt |
35210238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 5308688 - 5308629
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
5308688 |
aaggctaaaatatg-ttttagtccctgcaaatatacctcgttttggttttagtccctgtaa |
5308629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 285 - 333
Target Start/End: Complemental strand, 5355114 - 5355066
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
5355114 |
taaagtatggttttggtccctgcaaatatgcctcgttttggttttagtc |
5355066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 300 - 340
Target Start/End: Complemental strand, 19758041 - 19758001
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19758041 |
gtccctgcaaatatgcctcattttggttttagtccctgtaa |
19758001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 23817036 - 23816976
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||| ||| ||||||||||| ||||||| ||||| ||||||| |
|
|
| T |
23817036 |
aaggctaaaatatggttttagtctctgtaaatatgtctcgttttggtattagttcctgtaa |
23816976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 24717227 - 24717283
Alignment:
| Q |
282 |
ggctaaaatatggtttt-ggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||| |||| ||||||| |
|
|
| T |
24717227 |
ggctaaaatatggtttttggtccctgtaaatatgtctcattttgattttggtccctg |
24717283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 285 - 329
Target Start/End: Complemental strand, 28529206 - 28529162
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
28529206 |
taaaatatggttttggtctctgcaaatatgtctcgttttggtttt |
28529162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 282 - 338
Target Start/End: Original strand, 41364884 - 41364940
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
||||||||||||||||| || || |||||||||||| ||||||||||||||||||| |
|
|
| T |
41364884 |
ggctaaaatatggttttaatctctacaaatatgtctcgttttggttttagtccctgt |
41364940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 43058752 - 43058808
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
43058752 |
ctaaaatatagttttagtccctgcaaatatgtcttgttttgattttagtccctgtaa |
43058808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 45021494 - 45021550
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcatttt-ggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||| |||||||||||||| |
|
|
| T |
45021494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtccctg |
45021550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 45228614 - 45228670
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||| ||| |||| ||||||||||||| |
|
|
| T |
45228614 |
aggctaaaatatggttttgggccccgcaaatatgcctcgtttttgttttagtccctg |
45228670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 46648717 - 46648657
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| ||| ||||||||||| ||| ||||| |
|
|
| T |
46648717 |
aaggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttaatccttgtaa |
46648657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 279 - 338
Target Start/End: Original strand, 1559340 - 1559399
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||| ||| ||||| ||||| ||||||| |
|
|
| T |
1559340 |
taaggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttaatccctgt |
1559399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 30352904 - 30352849
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
30352904 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtccctg |
30352849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 281 - 332
Target Start/End: Original strand, 38486477 - 38486528
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||| |||| |||||||| |
|
|
| T |
38486477 |
aggctaaaatatgattttggtccctgtaaatatgtctcgttttagttttagt |
38486528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 285 - 340
Target Start/End: Original strand, 45671217 - 45671272
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| |||| |||||||| ||||||| |
|
|
| T |
45671217 |
taaaatatggttttagtccatgcaaatatgtctcgttttagttttagttcctgtaa |
45671272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 333
Target Start/End: Complemental strand, 3808106 - 3808068
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3808106 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
3808068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 3975766 - 3975724
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
3975766 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
3975724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 5233881 - 5233923
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
5233881 |
ttttggtccctgcaaatatgtcccattttggttttggtccctg |
5233923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 329
Target Start/End: Complemental strand, 8144585 - 8144551
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
8144585 |
ttttggtccctgcaaatatgtctcattttggtttt |
8144551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 9659428 - 9659470
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
9659428 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
9659470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 282 - 332
Target Start/End: Original strand, 19005598 - 19005648
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||| ||||| ||||||| |
|
|
| T |
19005598 |
ggctaaaatatagttttggtccctgtaaatatgtctcgttttgattttagt |
19005648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 21223405 - 21223463
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| || |||||||||||||| |||||| |
|
|
| T |
21223405 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtctctgtaa |
21223463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 21554393 - 21554451
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| |||| ||||||| ||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
21554393 |
ggctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagtccttgtaa |
21554451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 27458472 - 27458514
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
27458472 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
27458514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 31503710 - 31503668
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
31503710 |
ttttggtccctgcaaatatgtctcattttagttttggtccctg |
31503668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 35837997 - 35838039
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
35837997 |
ttttggtccctgtaaatatgtctcattttggttttggtccctg |
35838039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 285 - 343
Target Start/End: Original strand, 37527061 - 37527118
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||| |||| | |||||| |||| ||||||||||||| |
|
|
| T |
37527061 |
taaaatatggttttggtccctgcaaa-atgttttattttgattttggtccctgtaattt |
37527118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 279 - 333
Target Start/End: Complemental strand, 37953054 - 37953000
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
||||| |||||||||||||| ||||||| |||||||||| |||||||||||||| |
|
|
| T |
37953054 |
taaggataaaatatggttttagtccctgtaaatatgtcttgttttggttttagtc |
37953000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 39438956 - 39438914
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
39438956 |
ttttggtccctgcaaatatgtcttattttggttttggtccctg |
39438914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #181
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 41054103 - 41054061
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
41054103 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
41054061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #182
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 280 - 334
Target Start/End: Original strand, 46304084 - 46304138
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||| ||| ||||||||||||||| |
|
|
| T |
46304084 |
aaggctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagtcc |
46304138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #183
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 285 - 334
Target Start/End: Original strand, 14738603 - 14738652
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||| |||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14738603 |
taaaatattattttagtccctgcaaatatgcctcattttggttttagtcc |
14738652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #184
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 295 - 336
Target Start/End: Original strand, 30223534 - 30223575
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
30223534 |
ttttggtccctgcaaatatgtttcattttggttttggtccct |
30223575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #185
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 279 - 340
Target Start/End: Original strand, 30709322 - 30709383
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||| ||||||||| |||| |||||| |||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
30709322 |
taaggttaaaatatgattttagtccctacaaatatgcctcgttttggttttagtccttgtaa |
30709383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #186
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 279 - 328
Target Start/End: Complemental strand, 31310682 - 31310633
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttt |
328 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| || ||||||||| |
|
|
| T |
31310682 |
taaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #187
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 282 - 334
Target Start/End: Complemental strand, 1007229 - 1007177
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| ||| ||||| ||||||||| |
|
|
| T |
1007229 |
ggctaaaatatggttttagtccctccaaatatgcctcgttttgattttagtcc |
1007177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #188
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 6911080 - 6911140
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
6911080 |
aaggctaaaatatgattttggtccttataaatatgtctcgttttgattttagtccttgtaa |
6911140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #189
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 282 - 330
Target Start/End: Complemental strand, 6911247 - 6911199
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
330 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||| ||||||||||| |
|
|
| T |
6911247 |
ggctaaaatatggttttggttcctgcaaatatacctcgttttggtttta |
6911199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #190
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 285 - 333
Target Start/End: Complemental strand, 18891562 - 18891514
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||| |||||||| |
|
|
| T |
18891562 |
taaaatatggttttagtccctgcaaatatgtctcgttttaattttagtc |
18891514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #191
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 295 - 335
Target Start/End: Complemental strand, 19005865 - 19005825
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccc |
335 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
19005865 |
ttttggtccctgcaaatatgtctcgttttggttttggtccc |
19005825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #192
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 31732453 - 31732393
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||| ||||| |||||| || ||||| |
|
|
| T |
31732453 |
aaggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagcccttgtaa |
31732393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #193
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 316
Target Start/End: Complemental strand, 36687265 - 36687229
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtc |
316 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36687265 |
aaggctaaaatatgattttggtccctgcaaatatgtc |
36687229 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #194
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 281 - 333
Target Start/End: Complemental strand, 38486791 - 38486739
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||| | | |||||||||||||| |
|
|
| T |
38486791 |
aggctaaaatatggttttgatccctgtaaatatgccccgttttggttttagtc |
38486739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #195
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 44344455 - 44344515
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| || || ||||||||||||| ||| ||||||| ||| ||||| |
|
|
| T |
44344455 |
aaggctaaaatatggttttagttcccgcaaatatgtctcgtttcggttttaatccttgtaa |
44344515 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #196
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 304 - 343
Target Start/End: Complemental strand, 3954172 - 3954133
Alignment:
| Q |
304 |
ctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
3954172 |
ctgcatatatgtctcgttttggttttagtccctgtaattt |
3954133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #197
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 300 - 343
Target Start/End: Original strand, 22364673 - 22364716
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
22364673 |
gtccctgcaaatatctgacattttggttttagtccctgtaattt |
22364716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #198
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 285 - 332
Target Start/End: Original strand, 25547256 - 25547303
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||| ||||||||||||| |
|
|
| T |
25547256 |
taaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
25547303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #199
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 285 - 343
Target Start/End: Complemental strand, 44841711 - 44841659
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
44841711 |
taaaatatggttttggtccctgcaaatatgactc------gttttagtccctgtaattt |
44841659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #200
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 285 - 336
Target Start/End: Complemental strand, 45671545 - 45671494
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||| |||| |||||||||||| |
|
|
| T |
45671545 |
taaaatatggttttagtcattgcaaatatgtctcgttttagttttagtccct |
45671494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #201
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 5355045 - 5355003
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
5355045 |
ttttggtccctgcaaatatgcttcattttggttttggtccctg |
5355003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #202
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 6891967 - 6892009
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||| ||||||| |
|
|
| T |
6891967 |
ttttggtctctgcaaatatgcctcattttggttttggtccctg |
6892009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #203
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 279 - 313
Target Start/End: Original strand, 13418947 - 13418981
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13418947 |
taaggctaaaatatgtttttggtccctgcaaatat |
13418981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #204
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 16940835 - 16940877
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||| ||||||| |
|
|
| T |
16940835 |
ttttggtccttgcaaatatgcctcattttggttttggtccctg |
16940877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #205
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 281 - 335
Target Start/End: Original strand, 20355407 - 20355461
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccc |
335 |
Q |
| |
|
||||||||||||| ||||| ||| |||||||||| ||| |||||||| ||||||| |
|
|
| T |
20355407 |
aggctaaaatatgattttgatccttgcaaatatgactcgttttggttgtagtccc |
20355461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #206
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 20388675 - 20388617
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||| ||| ||||||| ||| ||||| ||||||| ||||||| |
|
|
| T |
20388675 |
ggctaaaatatggttttagtcgctgaaaatatgcctcgttttgattttagttcctgtaa |
20388617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #207
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 280 - 314
Target Start/End: Original strand, 35212066 - 35212100
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatg |
314 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
35212066 |
aaggctaaaatatgtttttggtccctgcaaatatg |
35212100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #208
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 35470207 - 35470165
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
35470207 |
tttttgtccctgcaaatatgcctcattttggttttggtccctg |
35470165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #209
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 35665948 - 35665990
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||| ||||||| |
|
|
| T |
35665948 |
ttttggtccttgcaaatatgtctcgttttggttttggtccctg |
35665990 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #210
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 280 - 330
Target Start/End: Original strand, 36684533 - 36684583
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
330 |
Q |
| |
|
||||||||||||||| |||| ||| ||||||||| |||| ||||||||||| |
|
|
| T |
36684533 |
aaggctaaaatatggctttgatccatgcaaatatatctcgttttggtttta |
36684583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #211
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 39520471 - 39520513
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| ||||||| |
|
|
| T |
39520471 |
ttttggtccctccaaatatatctcattttggttttggtccctg |
39520513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #212
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 329
Target Start/End: Original strand, 44841428 - 44841462
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
44841428 |
ttttggtccctgcaaatatgtctcgttttggtttt |
44841462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #213
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 48852517 - 48852559
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| ||||||| |
|
|
| T |
48852517 |
ttttggtccctgcaaatatgcctcattttgattttggtccctg |
48852559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #214
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 18311581 - 18311638
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| ||| || |||||||| ||| ||||||||||| || |||||| |
|
|
| T |
18311581 |
gctaaaatatggttttagtctctacaaatatgcctcgttttggttttattctctgtaa |
18311638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #215
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 280 - 313
Target Start/End: Original strand, 24195605 - 24195638
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
24195605 |
aaggctaaaatatgtttttggtccctgcaaatat |
24195638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #216
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 310
Target Start/End: Complemental strand, 27037903 - 27037874
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaa |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
27037903 |
aggctaaaatatggttttggtccctgcaaa |
27037874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #217
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 343
Target Start/End: Original strand, 32189076 - 32189137
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| || ||||||||||| || |||||||| |
|
|
| T |
32189076 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttaatctttgtaattt |
32189137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #218
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 314
Target Start/End: Original strand, 40576765 - 40576798
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatg |
314 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
40576765 |
aggctaaaatatgcttttggtccctgcaaatatg |
40576798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #219
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 283 - 332
Target Start/End: Complemental strand, 41365213 - 41365164
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
|||||||||||||||| || || ||||||||| ||| ||||||||||||| |
|
|
| T |
41365213 |
gctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagt |
41365164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #220
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 41693643 - 41693700
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| | |||| |||||| ||||||| |
|
|
| T |
41693643 |
aaggctaaaatatgtttttgatccctgcaaatatggcgaatttgggttttggtccctg |
41693700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #221
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 288 - 328
Target Start/End: Original strand, 488720 - 488760
Alignment:
| Q |
288 |
aatatggttttggtccctgcaaatatgtctcattttggttt |
328 |
Q |
| |
|
||||||||||| |||| |||||||||||||| ||||||||| |
|
|
| T |
488720 |
aatatggttttagtccttgcaaatatgtctcgttttggttt |
488760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #222
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 313
Target Start/End: Complemental strand, 5611567 - 5611535
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
5611567 |
aggctaaaatatgattttggtccctgcaaatat |
5611535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #223
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 300 - 340
Target Start/End: Original strand, 12894059 - 12894099
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
12894059 |
gtccctgcaaatatgcctcgttttggttttaatccctgtaa |
12894099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #224
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 313
Target Start/End: Original strand, 12933418 - 12933450
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
12933418 |
aggctaaaatatgcttttggtccctgcaaatat |
12933450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #225
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 18926889 - 18926945
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| || | | |||||||| ||| ||||||||| ||||||||||| |
|
|
| T |
18926889 |
ctaaaatatggttttagttcattcaaatatgactcgttttggtttaagtccctgtaa |
18926945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #226
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 300 - 340
Target Start/End: Complemental strand, 19158060 - 19158020
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
19158060 |
gtccctgcaaatatctgacattttggttttagtccctgtaa |
19158020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #227
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 300 - 340
Target Start/End: Complemental strand, 20757459 - 20757419
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
20757459 |
gtccctgcaaatatctgacattttggttttagtccctgtaa |
20757419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #228
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 21488335 - 21488391
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| ||||||||||| | ||||||| |||||||||| ||||| |
|
|
| T |
21488335 |
ctaaaatatggttttgatccctgcaaatttacttcattttagttttagtccatgtaa |
21488391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #229
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 313
Target Start/End: Complemental strand, 24197163 - 24197131
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
24197163 |
aggctaaaatatgcttttggtccctgcaaatat |
24197131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #230
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 283 - 343
Target Start/End: Complemental strand, 30761003 - 30760943
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||| | ||| ||||||||||| ||||| ||||| ||| |||||||| |
|
|
| T |
30761003 |
gctaaaatatggttttgacctctgtaaatatgtctcgttttgattttaatccatgtaattt |
30760943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #231
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 313
Target Start/End: Complemental strand, 32197969 - 32197937
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
32197969 |
aggctaaaatatgcttttggtccctgcaaatat |
32197937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #232
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 282 - 314
Target Start/End: Original strand, 36748198 - 36748230
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatg |
314 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
36748198 |
ggctaaaatatgtttttggtccctgcaaatatg |
36748230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 274)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 271 - 340
Target Start/End: Original strand, 4034706 - 4034775
Alignment:
| Q |
271 |
taaatttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4034706 |
taaattaatatggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
4034775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 12741273 - 12741213
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12741273 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
12741213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 19844583 - 19844523
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19844583 |
aaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgtaa |
19844523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 278 - 337
Target Start/End: Original strand, 474040 - 474099
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
474040 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
474099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 280 - 343
Target Start/End: Original strand, 25615973 - 25616036
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
25615973 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaattt |
25616036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 277 - 340
Target Start/End: Complemental strand, 35569141 - 35569078
Alignment:
| Q |
277 |
tataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35569141 |
tataaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
35569078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 280 - 343
Target Start/End: Original strand, 47005152 - 47005215
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
47005152 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctgtaattt |
47005215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 47336582 - 47336523
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
47336582 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
47336523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 51550447 - 51550388
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51550447 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
51550388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 54608864 - 54608805
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
54608864 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
54608805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 285 - 343
Target Start/End: Original strand, 1721092 - 1721150
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1721092 |
taaaatatggttttggtccttgcaaatatgtctcattttggttttagtccctgtaattt |
1721150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 26090078 - 26090020
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26090078 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
26090020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 285 - 343
Target Start/End: Complemental strand, 40545836 - 40545778
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40545836 |
taaaatatgattttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
40545778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 282 - 343
Target Start/End: Original strand, 20644505 - 20644566
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20644505 |
ggctaaaatatagttttggtccctgcaaatatgtctcattttgattttagtccctgtaattt |
20644566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 279 - 340
Target Start/End: Original strand, 22008523 - 22008584
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22008523 |
taaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
22008584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 279 - 340
Target Start/End: Original strand, 22016041 - 22016102
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22016041 |
taaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
22016102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 281 - 342
Target Start/End: Complemental strand, 29490744 - 29490683
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaatt |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
29490744 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaatt |
29490683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 12740906 - 12740962
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12740906 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12740962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 31480134 - 31480194
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
31480134 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
31480194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 276 - 340
Target Start/End: Complemental strand, 48924246 - 48924182
Alignment:
| Q |
276 |
ttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||||||||| |
|
|
| T |
48924246 |
ttataaggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctgtaa |
48924182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 3830133 - 3830192
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3830133 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctgtaa |
3830192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 15979702 - 15979643
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
15979702 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctgtaa |
15979643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 30106221 - 30106159
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
30106221 |
aggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctgtaattt |
30106159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 39132907 - 39132845
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||| |||||||||||||| |
|
|
| T |
39132907 |
aggctaaaatatggttttggtccctgcaaatatgtttcatattggtttaagtccctgtaattt |
39132845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 281 - 343
Target Start/End: Original strand, 40545563 - 40545625
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||| ||||||||||||||||||| |
|
|
| T |
40545563 |
aggctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgtaattt |
40545625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 49323782 - 49323840
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
49323782 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
49323840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 53701663 - 53701605
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
53701663 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
53701605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 279 - 340
Target Start/End: Original strand, 4513260 - 4513321
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
4513260 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
4513321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 4513623 - 4513562
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4513623 |
taaggctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctgtaa |
4513562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 39436716 - 39436773
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39436716 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
39436773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 54608516 - 54608573
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
54608516 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
54608573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 474409 - 474353
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
474409 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
474353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 1721454 - 1721394
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
1721454 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgtaa |
1721394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 4950035 - 4950095
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
4950035 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
4950095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 279 - 343
Target Start/End: Original strand, 14772208 - 14772272
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||||||||||||| ||||||| |
|
|
| T |
14772208 |
taaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtcccggtaattt |
14772272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 28552384 - 28552328
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
28552384 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
28552328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 271 - 343
Target Start/End: Original strand, 35177244 - 35177316
Alignment:
| Q |
271 |
taaatttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||| || |||||||||||||| |||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
35177244 |
taaatataaaaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtttctgtaattt |
35177316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 45002387 - 45002327
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
45002387 |
aaggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgtaa |
45002327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 51550081 - 51550137
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
51550081 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
51550137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 280 - 343
Target Start/End: Complemental strand, 3387606 - 3387543
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||| ||||||||||||||| |||||||| |
|
|
| T |
3387606 |
aaggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccatgtaattt |
3387543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 9603920 - 9603861
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| || |||||| |
|
|
| T |
9603920 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttattctctgtaa |
9603861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 22008890 - 22008835
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
22008890 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
22008835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 28552020 - 28552079
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||| |||||||||||||||| |
|
|
| T |
28552020 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctgtaa |
28552079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 267 - 334
Target Start/End: Original strand, 29525090 - 29525157
Alignment:
| Q |
267 |
tgattaaatttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||| || |||||||||||||||||||| ||||||||||||||||||| |||| |||||||||| |
|
|
| T |
29525090 |
tgattaaaattttaaggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtcc |
29525157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 30034473 - 30034414
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30034473 |
aggctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctgtaa |
30034414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 30128283 - 30128342
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||||||||| ||||||| |
|
|
| T |
30128283 |
aggctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctgtaa |
30128342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 30130157 - 30130216
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
30130157 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaa |
30130216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 31869957 - 31869898
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
31869957 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctgtaa |
31869898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 280 - 343
Target Start/End: Original strand, 35565506 - 35565569
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
35565506 |
aaggctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtccctgtaattt |
35565569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 43441270 - 43441325
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
43441270 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
43441325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 279 - 337
Target Start/End: Original strand, 3387262 - 3387320
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3387262 |
taaggttaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
3387320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 281 - 343
Target Start/End: Original strand, 4321945 - 4322007
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||| || ||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4321945 |
aggctaaaatatggttctgatccttgcaaatatgtctcattttggttttaatccctgtaattt |
4322007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 9261789 - 9261847
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
9261789 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
9261847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 281 - 335
Target Start/End: Complemental strand, 9262156 - 9262102
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccc |
335 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
9262156 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
9262102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 279 - 337
Target Start/End: Complemental strand, 20612901 - 20612843
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
20612901 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
20612843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 278 - 340
Target Start/End: Original strand, 21553885 - 21553947
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| |||| ||||||| |||||||| |
|
|
| T |
21553885 |
ataaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagcccctgtaa |
21553947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 25710870 - 25710812
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
25710870 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
25710812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 279 - 341
Target Start/End: Original strand, 29686541 - 29686603
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaat |
341 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29686541 |
taaggctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtccctgtaat |
29686603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 279 - 333
Target Start/End: Original strand, 39288570 - 39288624
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
39288570 |
taaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
39288624 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 46622130 - 46622068
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| || |||||||||||||||||| ||||| |
|
|
| T |
46622130 |
aggctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtccctgaaattt |
46622068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 279 - 337
Target Start/End: Original strand, 47336225 - 47336283
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
47336225 |
taaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
47336283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 279 - 337
Target Start/End: Original strand, 51834605 - 51834663
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
51834605 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
51834663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 282 - 343
Target Start/End: Complemental strand, 4035053 - 4034992
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||| |||||||| |||||||||| |
|
|
| T |
4035053 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagttcctgtaattt |
4034992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 4322192 - 4322131
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4322192 |
taaggttaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctgtaa |
4322131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 282 - 343
Target Start/End: Complemental strand, 7957226 - 7957165
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
7957226 |
ggctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtccctgtaattt |
7957165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 8940527 - 8940470
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
8940527 |
aaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
8940470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 9597098 - 9597037
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
9597098 |
taaggctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtccctgtaa |
9597037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 11463233 - 11463290
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
11463233 |
gctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtccctgtaa |
11463290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 28427610 - 28427553
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
28427610 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28427553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 32119586 - 32119529
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
32119586 |
aaggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
32119529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 281 - 334
Target Start/End: Original strand, 34238597 - 34238650
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34238597 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
34238650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 37507224 - 37507167
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
37507224 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37507167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 279 - 340
Target Start/End: Original strand, 38232238 - 38232299
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
38232238 |
taaggctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagtccttgtaa |
38232299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 39437111 - 39437054
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
39437111 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
39437054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 282 - 335
Target Start/End: Complemental strand, 40370589 - 40370536
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccc |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
40370589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccc |
40370536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 43441605 - 43441548
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
43441605 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
43441548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 282 - 343
Target Start/End: Complemental strand, 45313863 - 45313802
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||| |||||||||||||||||| |
|
|
| T |
45313863 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttgattttagtccctgtaattt |
45313802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 45320982 - 45320921
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
45320982 |
taaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
45320921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 333
Target Start/End: Original strand, 47114485 - 47114538
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
47114485 |
aaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
47114538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 863654 - 863594
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
863654 |
aaggttaaaatatggttttggtccctgcaaatatgtttcgttttgattttagtccctgtaa |
863594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 3152112 - 3152056
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
3152112 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
3152056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 278 - 330
Target Start/End: Original strand, 4814536 - 4814588
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
330 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
4814536 |
ataaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 5345691 - 5345631
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
5345691 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
5345631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 21159451 - 21159511
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
21159451 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaa |
21159511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 22155928 - 22155984
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
22155928 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
22155984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 276 - 340
Target Start/End: Original strand, 25710504 - 25710568
Alignment:
| Q |
276 |
ttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| ||||| |||||||||||| ||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
25710504 |
ttattaggctcaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
25710568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 283 - 343
Target Start/End: Complemental strand, 28418899 - 28418839
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
28418899 |
gctaaaatatggttttggtccctgcaaatatgttttgttttgattttagtccctgtaattt |
28418839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 28427244 - 28427300
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||| |||||||||||||||||| |
|
|
| T |
28427244 |
aggctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctg |
28427300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 30268503 - 30268563
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
30268503 |
aaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
30268563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 32119219 - 32119275
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
32119219 |
aggctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtccctg |
32119275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 37506866 - 37506922
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
37506866 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37506922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 45002020 - 45002076
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
45002020 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
45002076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 285 - 337
Target Start/End: Complemental strand, 49324143 - 49324091
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
49324143 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctg |
49324091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 283 - 343
Target Start/End: Original strand, 50008921 - 50008981
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| | |||||||||||||||||| |||||| |
|
|
| T |
50008921 |
gctagaatatggttttggtccctgcaaatatgttttattttggttttagtccctataattt |
50008981 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 50196301 - 50196357
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
50196357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 51759817 - 51759877
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| | || |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51759817 |
aaggctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtccctgtaa |
51759877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 284 - 343
Target Start/End: Original strand, 2486581 - 2486640
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||||| | |||||||| |
|
|
| T |
2486581 |
ctaaaatatggtttttgtccctgcaaatatgactcattttggttttagttcatgtaattt |
2486640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 336
Target Start/End: Original strand, 3151749 - 3151804
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
3151749 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
3151804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 3830517 - 3830458
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
3830517 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
3830458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 8510214 - 8510269
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
8510214 |
ggctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctg |
8510269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 336
Target Start/End: Original strand, 9603628 - 9603683
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
9603628 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccct |
9603683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 10976978 - 10977033
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
10976978 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
10977033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 15979338 - 15979393
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
15979338 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
15979393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 21159818 - 21159759
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
21159818 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
21159759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 26089730 - 26089785
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
26089730 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
26089785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 28452146 - 28452205
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
28452146 |
aggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtccttgtaa |
28452205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 278 - 337
Target Start/End: Complemental strand, 28942909 - 28942850
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| ||| |||||||||||||||||| |
|
|
| T |
28942909 |
ataaggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg |
28942850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 277 - 340
Target Start/End: Original strand, 29445949 - 29446012
Alignment:
| Q |
277 |
tataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| |||||||||||| |||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
29445949 |
tatatggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
29446012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 29446207 - 29446148
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
29446207 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccttgtaa |
29446148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 280 - 343
Target Start/End: Original strand, 29678022 - 29678085
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
29678022 |
aaggctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtccctgtaattt |
29678085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 31480500 - 31480445
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
31480500 |
ggctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtccctg |
31480445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 35407791 - 35407732
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
35407791 |
aggctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagtccctgtaa |
35407732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 276 - 343
Target Start/End: Original strand, 35533273 - 35533340
Alignment:
| Q |
276 |
ttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||| |||||||||||| || |||||||| |
|
|
| T |
35533273 |
ttataagactaaaatatggttttggtctctgcaaatatgtcttgttttggttttagaccttgtaattt |
35533340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 40169654 - 40169599
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
40169654 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
40169599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 280 - 343
Target Start/End: Original strand, 40277820 - 40277883
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| || ||||||||||| |||||||||||| |
|
|
| T |
40277820 |
aaggctaaaatgtggttttggtccctgcaaatatgcttcgttttggttttactccctgtaattt |
40277883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 47005520 - 47005461
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
47005520 |
aggctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtccttgtaa |
47005461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 277 - 343
Target Start/End: Complemental strand, 2486907 - 2486841
Alignment:
| Q |
277 |
tataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| || ||||||||||| ||| |||||||| |
|
|
| T |
2486907 |
tataagactaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccttgtaattt |
2486841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 9863404 - 9863346
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
9863404 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctgtaa |
9863346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 281 - 339
Target Start/End: Complemental strand, 13514578 - 13514520
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
339 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
13514578 |
aggctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagtccatgta |
13514520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 283 - 337
Target Start/End: Complemental strand, 22156292 - 22156238
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
22156292 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22156238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 275 - 337
Target Start/End: Original strand, 26799881 - 26799943
Alignment:
| Q |
275 |
tttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
26799881 |
tttaaaaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
26799943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 285 - 343
Target Start/End: Original strand, 36672966 - 36673024
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
36672966 |
taaaatatggttttggtctctgcaaatatgtcttgttttggttttagtctctgtaattt |
36673024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 40370285 - 40370343
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||| |||||||| ||||||| |
|
|
| T |
40370285 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagttcctgtaa |
40370343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 50261936 - 50261878
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
50261936 |
ggctaaaatatcgttttagtccctgcaaatatgtttcattttggttttagtctctgtaa |
50261878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 279 - 336
Target Start/End: Complemental strand, 4814901 - 4814845
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
4814901 |
taaggctaaaatatggttttagtcc-tgcaaatatgtctcgttttggttttagtccct |
4814845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 13584369 - 13584312
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || |||||||||||||||||| |
|
|
| T |
13584369 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
13584312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 14633891 - 14633834
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14633891 |
aaggctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
14633834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 282 - 339
Target Start/End: Original strand, 16123139 - 16123196
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
339 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||| ||| |||||||||||||||||||| |
|
|
| T |
16123139 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctgta |
16123196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 16679965 - 16679904
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||| |||| |||||||||||||||| |||||||||||| ||||| ||||||||| |
|
|
| T |
16679965 |
taaggctaaaagatggctttggtccctgcaaatttgtctcattttgattttaatccctgtaa |
16679904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 283 - 340
Target Start/End: Complemental strand, 25610129 - 25610072
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||| ||||||||| ||||| |
|
|
| T |
25610129 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccttgtaa |
25610072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 30552480 - 30552423
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||| ||||| |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
30552480 |
aaggctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtccctg |
30552423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 283 - 332
Target Start/End: Complemental strand, 36673244 - 36673195
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
36673244 |
gctaaaatatggttttggtccctgcaaatatgacttattttggttttagt |
36673195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 279 - 332
Target Start/End: Original strand, 36732637 - 36732690
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36732637 |
taaggttaaaataaggttttggtccctgcaaatatgtcttattttggttttagt |
36732690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 40169342 - 40169399
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
40169342 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccctg |
40169399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 279 - 340
Target Start/End: Original strand, 46751268 - 46751329
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
46751268 |
taaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccttgtaa |
46751329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 281 - 330
Target Start/End: Original strand, 52342194 - 52342243
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
52342194 |
aggctaaaatatggttttggtccctgcaaatatgcctccttttggtttta |
52342243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 52342586 - 52342525
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
52342586 |
taaggctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagtccatgtaa |
52342525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 280 - 329
Target Start/End: Original strand, 53113441 - 53113490
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
53113441 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttgttttt |
53113490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 12673642 - 12673702
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| ||||| ||||||| ||||||| ||| ||||||||||||||||||||| |
|
|
| T |
12673642 |
aaggctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctgtaa |
12673702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 282 - 338
Target Start/End: Original strand, 15016388 - 15016444
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
15016388 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctgt |
15016444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 281 - 341
Target Start/End: Complemental strand, 27681683 - 27681623
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaat |
341 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
27681683 |
aggctaaaatatggttctggtctctgcaaatatgcctcgttttggttttaatccctgtaat |
27681623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 28452377 - 28452321
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| || |||||||||||||||||| |
|
|
| T |
28452377 |
aggctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtccctg |
28452321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 29955300 - 29955356
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaa |
29955356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 30004454 - 30004510
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctgtaa |
30004510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 278 - 334
Target Start/End: Complemental strand, 30130508 - 30130452
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||| |||||||||||| ||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
30130508 |
ataaggctcaaatatggttttagtcactgcaaatatgcctcattttggttttagtcc |
30130452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 31869596 - 31869652
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| | |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31869596 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtccctgtaa |
31869652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 39288899 - 39288843
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
39288899 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
39288843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 40979712 - 40979652
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
40979712 |
aaggctaaaatatggttttaatccctgcaaatatggctcgttttggttttaatccctgtaa |
40979652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 336
Target Start/End: Original strand, 43440493 - 43440549
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||| |||| |||||||||||| |
|
|
| T |
43440493 |
aaggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccct |
43440549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 285 - 337
Target Start/End: Original strand, 45005889 - 45005941
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
45005889 |
taaaatatggttttgatccctgcaaatatgtctcgttttgattttagtccctg |
45005941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 46186773 - 46186713
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||| |||||||||||||| |||||| |
|
|
| T |
46186773 |
aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtctctgtaa |
46186713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 51500686 - 51500630
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
51500686 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccctg |
51500630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 51834943 - 51834887
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || |||||||||||||||||| |
|
|
| T |
51834943 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
51834887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 863280 - 863339
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||| |||| ||||||||| |||||| |
|
|
| T |
863280 |
aggctaaaatatgattttggtccatgcaaatatgtctcgttttagttttagtctctgtaa |
863339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 7588317 - 7588376
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
| T |
7588317 |
aggctaaaatatagttttggtccctgcaaatatgccttgttttggttttagtctctgtaa |
7588376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 278 - 333
Target Start/End: Original strand, 20611016 - 20611071
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
20611016 |
ataaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
20611071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 29955667 - 29955608
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
29955667 |
aggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
29955608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 30004822 - 30004763
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
30004822 |
aggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
30004763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 288 - 343
Target Start/End: Complemental strand, 38232594 - 38232539
Alignment:
| Q |
288 |
aatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||| |||| ||||||||| |
|
|
| T |
38232594 |
aatatggttttggtacctgcaaatatgtctcgttttggtttcagtctctgtaattt |
38232539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 285 - 340
Target Start/End: Original strand, 45161116 - 45161171
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
45161116 |
taaaatatggtttaagtccctgcaaatatgtctcgttttggttttagtctctgtaa |
45161171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 50196658 - 50196599
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| ||| |||| |||||||||||||||| |
|
|
| T |
50196658 |
aggctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtccctgtaa |
50196599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 285 - 340
Target Start/End: Complemental strand, 54767524 - 54767469
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||| |
|
|
| T |
54767524 |
taaaatatggttttggtccctagaaatatgtctcgttttgattttagtccctgtaa |
54767469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 474335 - 474293
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
474335 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
474293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 863579 - 863537
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
863579 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
863537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 12740980 - 12741022
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12740980 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
12741022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 15979411 - 15979453
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15979411 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
15979453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 19844265 - 19844323
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||| |||| ||||||||||||||| |
|
|
| T |
19844265 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttaattttagtccctgtaa |
19844323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 22008817 - 22008775
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22008817 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
22008775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 22016335 - 22016293
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22016335 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
22016293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 28552310 - 28552268
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28552310 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
28552268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 30424628 - 30424686
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||| ||||||||| |||||| |
|
|
| T |
30424628 |
ggctaaaatatggttttagtccctgcaaatatgtcttgttttagttttagtctctgtaa |
30424686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 31480427 - 31480385
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31480427 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
31480385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 32119511 - 32119469
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32119511 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
32119469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 279 - 337
Target Start/End: Original strand, 34582521 - 34582579
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34582521 |
taaggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctg |
34582579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 44802282 - 44802340
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || ||||||||||||| ||||||| |
|
|
| T |
44802282 |
ggctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcctgtaa |
44802340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 49324073 - 49324031
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
49324073 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
49324031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 54608591 - 54608633
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
54608591 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
54608633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 288 - 337
Target Start/End: Complemental strand, 8510523 - 8510474
Alignment:
| Q |
288 |
aatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||| |||||||||||||||| || |||||||||||||||||| |
|
|
| T |
8510523 |
aatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
8510474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 9596759 - 9596816
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| || ||||||||||||||||||||| |
|
|
| T |
9596759 |
gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtccctgtaa |
9596816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 10977343 - 10977286
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
10977343 |
aaggctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtccctg |
10977286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 284 - 337
Target Start/End: Original strand, 14633547 - 14633600
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| |||||||||||| ||||| |
|
|
| T |
14633547 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaggccctg |
14633600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 285 - 338
Target Start/End: Complemental strand, 20907454 - 20907401
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
20907454 |
taaaatatggttttaatccctgcaaatatgcctcattttggttttagtctctgt |
20907401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 292 - 337
Target Start/End: Complemental strand, 25610061 - 25610016
Alignment:
| Q |
292 |
tggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
25610061 |
tggttttggtccctgcaaatatgtctcgttttggttttggtccctg |
25610016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 295 - 336
Target Start/End: Original strand, 47336301 - 47336342
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47336301 |
ttttggtccctgcaaatatgtctcattttggttttggtccct |
47336342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 282 - 343
Target Start/End: Complemental strand, 50009284 - 50009223
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||| |||||||||||||| |||||||||| ||| ||||| ||||| |||||||||||| |
|
|
| T |
50009284 |
ggctaaactatggttttggtccttgcaaatatgcctcgttttgattttaatccctgtaattt |
50009223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 275443 - 275499
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||| ||| ||||| |||||||||||| |
|
|
| T |
275443 |
aggctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtccctg |
275499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 7518088 - 7518148
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||| ||| |||| |||||||||| ||||| |
|
|
| T |
7518088 |
aaggctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagtccttgtaa |
7518148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 284 - 332
Target Start/End: Complemental strand, 7518444 - 7518396
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
7518444 |
ctaaaatatggttttactccctgcaaatatgtctcgttttggttttagt |
7518396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 285 - 341
Target Start/End: Complemental strand, 8555305 - 8555249
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaat |
341 |
Q |
| |
|
||||||||||||||||||| |||||||||| || ||||||||||||||| |||||| |
|
|
| T |
8555305 |
taaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccttgtaat |
8555249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 8940158 - 8940218
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| ||||||||||||||| || |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
8940158 |
aaggttaaaatatggttttgatctctgcaaatatacctcgttttggttttagtccctgtaa |
8940218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 283 - 343
Target Start/End: Complemental strand, 11463480 - 11463420
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||| |||| ||||||| ||| ||| |||||||||||||| ||||||||| |
|
|
| T |
11463480 |
gctaaaatatggtttcggtcgctgcaaaaatgcctcgttttggttttagtctctgtaattt |
11463420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 284 - 340
Target Start/End: Complemental strand, 14772523 - 14772467
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| || | ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14772523 |
ctaaaatatggttttagtacatgcaaatatacctcattttggttttagtccctgtaa |
14772467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 19656539 - 19656599
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||| ||||| ||||||||| ||||| |
|
|
| T |
19656539 |
aaggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccttgtaa |
19656599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 20644878 - 20644818
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| | | ||||| ||||||||||||||| |
|
|
| T |
20644878 |
aaggctaaaatatggttttggtccctgtaaatataccccgttttgattttagtccctgtaa |
20644818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 279 - 343
Target Start/End: Original strand, 35936777 - 35936841
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| || ||||||||||| |||| ||||||| |
|
|
| T |
35936777 |
taaggctaaaatatggttttggtccctacaaatatacttcgttttggttttaatccccgtaattt |
35936841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 284 - 340
Target Start/End: Complemental strand, 45006247 - 45006191
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||| ||||| ||||||||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctgtaa |
45006191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 283 - 343
Target Start/End: Complemental strand, 46724901 - 46724841
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||| || |||||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
46724901 |
gctaaaatatggttttgatctctgcaaatatgttttgttttgattttagtccctgtaattt |
46724841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 18175791 - 18175847
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
18175791 |
ggctaaaatatggttttagtccctgcaaatatgtctc--gttggttttaatccctgtaa |
18175847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 20405224 - 20405165
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||| |||||||||||||||| |
|
|
| T |
20405224 |
aggctaaaatatggttttggtccctgcaaatatactttgttttagttttagtccctgtaa |
20405165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 285 - 336
Target Start/End: Original strand, 20757403 - 20757454
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccct |
20757454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 25609766 - 25609825
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||| | |||||| | ||| ||||||||||||||||||||| |
|
|
| T |
25609766 |
aggctaaaatatggttttggtctttacaaataagcctcgttttggttttagtccctgtaa |
25609825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 281 - 332
Target Start/End: Original strand, 28942524 - 28942575
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || ||||||||||||| |
|
|
| T |
28942524 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
28942575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 281 - 332
Target Start/End: Original strand, 46901103 - 46901154
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||| || ||||||||||||| |
|
|
| T |
46901103 |
aggctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagt |
46901154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 283 - 333
Target Start/End: Complemental strand, 3361817 - 3361767
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
3361817 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
3361767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 3387338 - 3387380
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
3387338 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
3387380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 4034790 - 4034832
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
4034790 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
4034832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 7957154 - 7957112
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
7957154 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
7957112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 9262081 - 9262039
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
9262081 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
9262039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 9603702 - 9603744
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
9603702 |
ttttggtccctgcaaatatgtcttattttggttttggtccctg |
9603744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 26089803 - 26089845
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
26089803 |
ttttggtccctgcaaatatgtctctttttggttttggtccctg |
26089845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 280 - 334
Target Start/End: Complemental strand, 34238917 - 34238863
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||| || ||||||||||||||| |
|
|
| T |
34238917 |
aaggctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagtcc |
34238863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 333
Target Start/End: Original strand, 35565581 - 35565619
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35565581 |
ttttggtccctgcaaatatgcctcattttggttttagtc |
35565619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 36673036 - 36673078
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
36673036 |
ttttggtccctgcaaataagtctcattttggttttggtccctg |
36673078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 39072213 - 39072155
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||| ||||| ||||| ||||||||| |
|
|
| T |
39072213 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttgattttaatccctgtaa |
39072155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 39132834 - 39132792
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
39132834 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctg |
39132792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #216
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 280 - 326
Target Start/End: Complemental strand, 44802550 - 44802504
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggt |
326 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||| ||||||| |
|
|
| T |
44802550 |
aaggctaaaatatgattttgatccctgcaaatatgtctcgttttggt |
44802504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #217
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 45002094 - 45002136
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
45002094 |
ttttggtccctacaaatatgtctcattttggttttggtccctg |
45002136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #218
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 45005959 - 45006001
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
45005959 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
45006001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #219
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 329
Target Start/End: Original strand, 51550155 - 51550189
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
51550155 |
ttttggtccctgcaaatatgtctcattttggtttt |
51550189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #220
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 52342509 - 52342467
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
52342509 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
52342467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #221
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 52956627 - 52956585
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
52956627 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
52956585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #222
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 53701361 - 53701419
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| || ||||||||||| || ||||| |||||||||||||||| |
|
|
| T |
53701361 |
ggctaaaatatggttttaatctctgcaaatatgccttattttagttttagtccctgtaa |
53701419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #223
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 279 - 343
Target Start/End: Complemental strand, 11312571 - 11312507
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctca-ttttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||| ||| |||||||||||||||||| ||||| |
|
|
| T |
11312571 |
taaggctaaaatatggcattggtccatgcaaatatgt-tcagttttggttttagtccctgcaattt |
11312507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #224
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 279 - 332
Target Start/End: Complemental strand, 12673984 - 12673931
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
||||| ||||||||| |||| || |||||||||||| ||||||||||||||||| |
|
|
| T |
12673984 |
taaggttaaaatatgattttagttcctgcaaatatgcctcattttggttttagt |
12673931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #225
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 279 - 332
Target Start/End: Original strand, 27200435 - 27200488
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||| ||||||||| |||||||| |
|
|
| T |
27200435 |
taaggttaaaatatggttttaatccctgcaaatatatctcattttagttttagt |
27200488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #226
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 295 - 336
Target Start/End: Complemental strand, 28452303 - 28452262
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28452303 |
ttttagtccctgcaaatatgtctcattttggttttggtccct |
28452262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #227
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 290 - 343
Target Start/End: Original strand, 29490377 - 29490430
Alignment:
| Q |
290 |
tatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||| |||||||| | |||||||||||||||||||||||| |
|
|
| T |
29490377 |
tatggttttggtccctacaaatatgcaccgttttggttttagtccctgtaattt |
29490430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #228
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 282 - 343
Target Start/End: Complemental strand, 29678387 - 29678326
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| | |||||||||||| |||| |||||| |
|
|
| T |
29678387 |
ggctaaaatatgattttggtccctgcaaatatgccctgttttggttttagcccctttaattt |
29678326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #229
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 295 - 336
Target Start/End: Complemental strand, 40370515 - 40370474
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
40370515 |
ttttggtccctgcaaatatgcctcattttggttttggtccct |
40370474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #230
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 45521839 - 45521778
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||| |||||||||||||| ||| ||||||||||| || ||||||||||||| ||||||| |
|
|
| T |
45521839 |
taaggttaaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctgtaa |
45521778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #231
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 46186410 - 46186467
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||| ||||| ||||||||| ||||| |
|
|
| T |
46186410 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccttgtaa |
46186467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #232
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 281 - 333
Target Start/End: Original strand, 15286155 - 15286207
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || |||||||||||||| |
|
|
| T |
15286155 |
aggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtc |
15286207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #233
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 284 - 340
Target Start/End: Complemental strand, 19297947 - 19297891
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||| |||||||||| || ||||||||||| ||||| |||||||| |||||| |
|
|
| T |
19297947 |
ctaaaatatagttttggtccttgtaaatatgtctcgttttgtttttagtctctgtaa |
19297891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #234
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 30034109 - 30034165
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| || ||||||| ||| ||||||||||| ||| ||||| |
|
|
| T |
30034109 |
ctaaaatatggttttggtccttgtaaatatgcctcgttttggttttaatccttgtaa |
30034165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #235
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 281 - 313
Target Start/End: Complemental strand, 39820664 - 39820632
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39820664 |
aggctaaaatatggttttggtccctgcaaatat |
39820632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #236
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 332
Target Start/End: Complemental strand, 40279337 - 40279285
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||| ||||||| |
|
|
| T |
40279337 |
aaggctaaaatatggttttggtctttgcaaatatgtcttgttttgtttttagt |
40279285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #237
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 46724545 - 46724601
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||| ||||| ||| ||||||||| |||| |||| |||||||||||||||| |
|
|
| T |
46724545 |
ctaaaatatgattttgatccttgcaaatatatctcgttttagttttagtccctgtaa |
46724601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #238
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 281 - 313
Target Start/End: Complemental strand, 47433869 - 47433837
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
47433869 |
aggctaaaatatggttttggtccctgcaaatat |
47433837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #239
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 49670803 - 49670747
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccc-tgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||| || |||||||||||||||||| |
|
|
| T |
49670803 |
ggctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccctg |
49670747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #240
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 331
Target Start/End: Complemental strand, 51760117 - 51760069
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttag |
331 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| ||| |||||||||||| |
|
|
| T |
51760117 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag |
51760069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #241
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 295 - 338
Target Start/End: Complemental strand, 9597022 - 9596979
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||| |||||||| |
|
|
| T |
9597022 |
ttttggtccctgcaaatacgcctcattttggttttggtccctgt |
9596979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #242
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 285 - 336
Target Start/End: Original strand, 9863050 - 9863100
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||| |||||||| |||||| ||| ||||||||||||||||| |
|
|
| T |
9863050 |
taaaatatggttttagtccctgc-aatatgcctcgttttggttttagtccct |
9863100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #243
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 280 - 343
Target Start/End: Original strand, 10778368 - 10778431
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||| |||||||||||||| || ||||||||||| ||| ||||| ||||||| |||||||||| |
|
|
| T |
10778368 |
aaggttaaaatatggttttagtttctgcaaatatgcctcgttttgattttagttcctgtaattt |
10778431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #244
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 295 - 334
Target Start/End: Complemental strand, 11463408 - 11463369
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
11463408 |
ttttggtccctgcaaatatgcctcattttggttttggtcc |
11463369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #245
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 282 - 313
Target Start/End: Original strand, 27681326 - 27681357
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
27681326 |
ggctaaaatatggttttggtccctgcaaatat |
27681357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #246
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 35498415 - 35498474
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| ||| |||||| |||||||| || ||||||||||| ||||||||| |
|
|
| T |
35498415 |
aggctaaaatatgggtttagtccctacaaatatgattcgttttggttttaatccctgtaa |
35498474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #247
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 295 - 334
Target Start/End: Original strand, 47005227 - 47005266
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
47005227 |
ttttggtccctgcaaatatgtctcgttttggttttcgtcc |
47005266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #248
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 279 - 314
Target Start/End: Original strand, 52401014 - 52401049
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatg |
314 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52401014 |
taaggctaaaatatgtttttggtccctgcaaatatg |
52401049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #249
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 329
Target Start/End: Complemental strand, 8940452 - 8940418
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8940452 |
ttttgatccctgcaaatatgtctcattttggtttt |
8940418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #250
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 19844339 - 19844381
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||| ||||||| |
|
|
| T |
19844339 |
ttttggtccctgtaaatatgcctcattttggttttggtccctg |
19844381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #251
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 20644578 - 20644620
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
20644578 |
ttttgatccctgcaaatatgtctcgttttggttttggtccctg |
20644620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #252
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 280 - 314
Target Start/End: Complemental strand, 26800171 - 26800137
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatg |
314 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26800171 |
aaggctaaaatatggttttagtccctgcaaatatg |
26800137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #253
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 284 - 334
Target Start/End: Complemental strand, 43440785 - 43440735
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
43440785 |
ctaaaatataattttagtccctgcaaatatgcctcgttttggttttagtcc |
43440735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #254
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 329
Target Start/End: Original strand, 43441343 - 43441377
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43441343 |
ttttggtccctgcaaatatgtctcattttagtttt |
43441377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #255
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 275 - 313
Target Start/End: Complemental strand, 44507865 - 44507827
Alignment:
| Q |
275 |
tttataaggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
44507865 |
tttacaaggctaaaatatgattttggtccctgcaaatat |
44507827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #256
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 282 - 332
Target Start/End: Original strand, 52956383 - 52956433
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
||||||||||| ||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
52956383 |
ggctaaaatatacttttggtccctactaatatgtctcgttttggttttagt |
52956433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #257
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 279 - 313
Target Start/End: Original strand, 53121299 - 53121333
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
53121299 |
taaggctaaaatatgtttttggtccctgcaaatat |
53121333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #258
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 281 - 343
Target Start/End: Original strand, 54767170 - 54767232
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||| || ||| |||||| | | |||||||||||||||||||||||| |
|
|
| T |
54767170 |
aggctaaaatatggttttattctctgaaaatatattttcttttggttttagtccctgtaattt |
54767232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #259
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 7956870 - 7956927
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||||||| | ||||||| |
|
|
| T |
7956870 |
gctaaaatatggttttggtctttgtaaatatgcttcattttggttttaattcctgtaa |
7956927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #260
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 285 - 334
Target Start/End: Original strand, 20807800 - 20807849
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| ||||||||| |
|
|
| T |
20807800 |
taaaatatggttttagtccctgcaaatatacgtcattttgattttagtcc |
20807849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #261
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 303 - 340
Target Start/End: Original strand, 20907158 - 20907195
Alignment:
| Q |
303 |
cctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
20907158 |
cctgtaaatatgtctcgttttggttttagtccctgtaa |
20907195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #262
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 282 - 335
Target Start/End: Complemental strand, 30426226 - 30426174
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccc |
335 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||| ||||| |||||||||| |
|
|
| T |
30426226 |
ggctaaaatatggttttagtcc-tgcaaatatgcctcgttttgattttagtccc |
30426174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #263
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 275 - 336
Target Start/End: Original strand, 30552140 - 30552200
Alignment:
| Q |
275 |
tttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||| ||| |||||||||||||| | || ||||||||||||| ||||||||||||||||| |
|
|
| T |
30552140 |
tttattaggttaaaatatggttttagacc-tgcaaatatgtcttgttttggttttagtccct |
30552200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #264
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 280 - 313
Target Start/End: Complemental strand, 40477435 - 40477402
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
40477435 |
aaggctaaaatatgattttggtccctgcaaatat |
40477402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #265
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 314
Target Start/End: Original strand, 42446525 - 42446558
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatg |
314 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
42446525 |
aggctaaaatatgcttttggtccctgcaaatatg |
42446558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #266
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 280 - 313
Target Start/End: Original strand, 44506580 - 44506613
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
44506580 |
aaggctaaaatatggttttagtccctgcaaatat |
44506613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #267
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 338
Target Start/End: Complemental strand, 47114804 - 47114747
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||| | || |||| |||||||| ||||| |
|
|
| T |
47114804 |
aggctaaaatatagttttggtccttgcaaatatatttcgttttagttttagttcctgt |
47114747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #268
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 314
Target Start/End: Complemental strand, 52403184 - 52403151
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatg |
314 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
52403184 |
aggctaaaatatgcttttggtccctgcaaatatg |
52403151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #269
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 283 - 343
Target Start/End: Original strand, 11311433 - 11311493
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||| |||||| |||||||||| || |||||||||||||||||||||||| |
|
|
| T |
11311433 |
gctaaaatatgacgttggtctctgcaaatatatccagttttggttttagtccctgtaattt |
11311493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #270
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 280 - 324
Target Start/End: Original strand, 25353197 - 25353241
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttg |
324 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||| ||| ||||| |
|
|
| T |
25353197 |
aaggctagaatatggttttagtccctgcaaatatgcctcgttttg |
25353241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #271
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 313
Target Start/End: Original strand, 46026075 - 46026107
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
46026075 |
aggctaaaatatgtttttggtccctgcaaatat |
46026107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #272
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 282 - 338
Target Start/End: Complemental strand, 47902145 - 47902089
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
||||||||||| ||||| ||||| ||||||||| | ||||||||||||||||||| |
|
|
| T |
47902145 |
ggctaaaatatagttttagtccccgcaaatatgcattgttttggttttagtccctgt |
47902089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #273
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 333
Target Start/End: Original strand, 51500397 - 51500449
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
|||||||||||||||| | ||| ||| ||||||| ||| |||||||||||||| |
|
|
| T |
51500397 |
aggctaaaatatggttctagtctctgtaaatatgcctcgttttggttttagtc |
51500449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #274
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 313
Target Start/End: Complemental strand, 54437527 - 54437495
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
54437527 |
aggctaaaatatgtttttggtccctgcaaatat |
54437495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 57; Significance: 9e-24; HSPs: 204)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 1381245 - 1381305
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1381245 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
1381305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 277 - 337
Target Start/End: Original strand, 18258157 - 18258217
Alignment:
| Q |
277 |
tataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
18258157 |
tataaggctaaaatatggttttggtccctgcaaatatggctcattttggttttagtccctg |
18258217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 277 - 337
Target Start/End: Original strand, 24443375 - 24443435
Alignment:
| Q |
277 |
tataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
24443375 |
tataaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
24443435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 280 - 343
Target Start/End: Original strand, 28213371 - 28213434
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
28213371 |
aaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccatgtaattt |
28213434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 45138 - 45196
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45138 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
45196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 281 - 343
Target Start/End: Original strand, 20690732 - 20690794
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
20690732 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtctctgtaattt |
20690794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 35928458 - 35928400
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35928458 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
35928400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 4736545 - 4736484
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
4736545 |
taaggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgtaa |
4736484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 282 - 343
Target Start/End: Original strand, 15916286 - 15916347
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
15916286 |
ggctaaaagatggttttggtccctgcaaatatgtctcattttggttttagtccctataattt |
15916347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 19565465 - 19565522
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19565465 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19565522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 282 - 339
Target Start/End: Original strand, 30888160 - 30888217
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30888160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgta |
30888217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 5917125 - 5917181
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5917125 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
5917181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 284 - 340
Target Start/End: Complemental strand, 6912855 - 6912799
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6912855 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
6912799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 18258529 - 18258469
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
18258529 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccttgtaa |
18258469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 281 - 337
Target Start/End: Original strand, 19685016 - 19685072
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19685016 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19685072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 19685382 - 19685322
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
19685382 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
19685322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 26133415 - 26133355
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26133415 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
26133355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 38170512 - 38170572
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
38170512 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
38170572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 280 - 343
Target Start/End: Complemental strand, 1287047 - 1286984
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1287047 |
aaggttaaaatatggttttggtccctgtaaatatgtctcattttggttttagttcctgtaattt |
1286984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 24443745 - 24443686
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
24443745 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
24443686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 35877053 - 35876994
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
35877053 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctgtaa |
35876994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 36577721 - 36577780
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36577721 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgtaa |
36577780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 279 - 337
Target Start/End: Complemental strand, 1381614 - 1381556
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
1381614 |
taaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1381556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 279 - 337
Target Start/End: Complemental strand, 5917463 - 5917405
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
5917463 |
taaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
5917405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 281 - 339
Target Start/End: Original strand, 26071290 - 26071348
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
339 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26071290 |
aggctaaaatatagtttcggtccctgcaaatatgtctcattttggttttagtccctgta |
26071348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 30800851 - 30800789
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
30800851 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaattt |
30800789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 278 - 340
Target Start/End: Complemental strand, 34125636 - 34125574
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
34125636 |
ataaggctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctgtaa |
34125574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 279 - 337
Target Start/End: Original strand, 40764412 - 40764470
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
40764412 |
taaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
40764470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 282 - 343
Target Start/End: Complemental strand, 5104001 - 5103940
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5104001 |
ggctaaaatatggttttggttcctgcaaatatgtctcattttggttttagtttctgtaattt |
5103940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 282 - 343
Target Start/End: Complemental strand, 29366949 - 29366888
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
29366949 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctgtaattt |
29366888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 35928062 - 35928119
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
35928062 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35928119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 37271708 - 37271651
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
37271708 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg |
37271651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 1105149 - 1105093
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
1105149 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1105093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 2217492 - 2217552
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
2217492 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
2217552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 7075570 - 7075630
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
7075570 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
7075630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 18046036 - 18046096
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
18046036 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
18046096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 19565832 - 19565776
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
19565832 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
19565776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 20660946 - 20661006
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
20660946 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccttgtaa |
20661006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 21124911 - 21124971
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
21124911 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaa |
21124971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 28863508 - 28863568
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
28863508 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
28863568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 36578085 - 36578025
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
36578085 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
36578025 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 277 - 337
Target Start/End: Complemental strand, 38496787 - 38496727
Alignment:
| Q |
277 |
tataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| || |||||||||||||||||| |
|
|
| T |
38496787 |
tataaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
38496727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 282 - 342
Target Start/End: Original strand, 42553642 - 42553702
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaatt |
342 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
42553642 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtctctgtaatt |
42553702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 1104857 - 1104916
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
1104857 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgtaa |
1104916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 4203771 - 4203712
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
4203771 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgtaa |
4203712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 5950175 - 5950234
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
5950175 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
5950234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 6912497 - 6912552
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
6912497 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
6912552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 10744055 - 10743996
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10744055 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctgtaa |
10743996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 280 - 343
Target Start/End: Complemental strand, 26071618 - 26071555
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||| ||||||||| ||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26071618 |
aaggttaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccctgtaattt |
26071555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 278 - 337
Target Start/End: Complemental strand, 29172890 - 29172831
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
29172890 |
ataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29172831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 29692743 - 29692802
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
29692743 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
29692802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 30800493 - 30800552
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
30800493 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
30800552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 37271358 - 37271417
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
37271358 |
aggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgtaa |
37271417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 285 - 343
Target Start/End: Complemental strand, 28108159 - 28108101
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggttttagtccctgtaattt |
28108101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 28863838 - 28863780
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
28863838 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
28863780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 33336026 - 33335968
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
33336026 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctgtaa |
33335968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 36973710 - 36973652
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||| |
|
|
| T |
36973710 |
ggctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctgtaa |
36973652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 40029497 - 40029439
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
40029497 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
40029439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 18633597 - 18633654
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
18633597 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18633654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 20986091 - 20986034
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
20986091 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
20986034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 281 - 338
Target Start/End: Original strand, 24781988 - 24782045
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24781988 |
aggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgt |
24782045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 28871997 - 28871936
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
28871997 |
taaggctaaattatggttttggtccctgcaaatatgcctcgttttggttttagttcctgtaa |
28871936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 35167167 - 35167110
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
35167167 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35167110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 282 - 343
Target Start/End: Original strand, 35609303 - 35609364
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| || |||||||||||||||||||||||| |
|
|
| T |
35609303 |
ggctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctgtaattt |
35609364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 35876686 - 35876743
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
35876686 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
35876743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 279 - 340
Target Start/End: Original strand, 40029138 - 40029199
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||| ||||||||||| ||||||||| |
|
|
| T |
40029138 |
taaggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttaatccctgtaa |
40029199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 40764782 - 40764725
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
40764782 |
aaggctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtccctg |
40764725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 272 - 340
Target Start/End: Original strand, 293818 - 293886
Alignment:
| Q |
272 |
aaatttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||||||| ||| ||||| ||||||||| ||||| |
|
|
| T |
293818 |
aaatttaaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccatgtaa |
293886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 3850600 - 3850544
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3850600 |
aggctgaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
3850544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 5614164 - 5614224
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
5614164 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaa |
5614224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 10743722 - 10743782
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
10743722 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
10743782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 16038375 - 16038435
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
16038375 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
16038435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 17070533 - 17070592
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
17070533 |
aaggctaaaatatggttttggtccctgcaaatatgtctc-gtttgattttagtccctgtaa |
17070592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 285 - 337
Target Start/End: Original strand, 20985728 - 20985780
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
20985780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 282 - 338
Target Start/End: Original strand, 28550827 - 28550883
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
28550827 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
28550883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 283 - 343
Target Start/End: Original strand, 29855614 - 29855674
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||| ||||||||| || ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29855614 |
gctaaaatatgattttggtccttggaaatatgcctcattttggttttagtccctgtaattt |
29855674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 29875726 - 29875670
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
29875726 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29875670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 284 - 332
Target Start/End: Complemental strand, 35609635 - 35609587
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35609587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 38786157 - 38786217
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
38786157 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctgtaa |
38786217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 40167784 - 40167844
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
40167784 |
aaggctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
40167844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 336
Target Start/End: Complemental strand, 2217855 - 2217800
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
2217855 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
2217800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 282 - 333
Target Start/End: Original strand, 2636669 - 2636720
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
2636669 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtc |
2636720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 283 - 334
Target Start/End: Complemental strand, 2636992 - 2636941
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
2636992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
2636941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 5614531 - 5614472
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
5614531 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctgtaa |
5614472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 11799459 - 11799400
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
11799459 |
aggctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccctgtaa |
11799400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 14318044 - 14318103
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
14318044 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccttgtaa |
14318103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 278 - 337
Target Start/End: Complemental strand, 15635711 - 15635652
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||| ||| |||||||||||||||||| |
|
|
| T |
15635711 |
ataaggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
15635652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 18046349 - 18046290
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
18046349 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
18046290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 23381949 - 23382008
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
23381949 |
aggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgtaa |
23382008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 25779163 - 25779104
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
25779163 |
aggctaaaatatggttttagtccctgcaaatatgcttcattttggttttagttcctgtaa |
25779104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 31037742 - 31037683
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||| || |||||| |
|
|
| T |
31037742 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttattctctgtaa |
31037683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 32108807 - 32108866
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||| |||||| ||||||||| |
|
|
| T |
32108807 |
aggctaaaatatggttttggtccctgcaaatatgtttcgttttagttttaatccctgtaa |
32108866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 36278080 - 36278139
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||| |||||||||| ||||| |
|
|
| T |
36278080 |
aggctaaaatatggttttgatccctgcaaatatgtttcattttagttttagtccatgtaa |
36278139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 336
Target Start/End: Complemental strand, 38555084 - 38555030
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38555084 |
aggctaaaatatggttt-ggtccctgcaaatatgcctcattttggttttagtccct |
38555030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 40168009 - 40167950
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| ||||| |||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40168009 |
aggctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtccctgtaa |
40167950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 42207241 - 42207300
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||| || ||||||||||| ||||||||||||||||||||| |
|
|
| T |
42207241 |
aggctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccctgtaa |
42207300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 285 - 340
Target Start/End: Complemental strand, 42596814 - 42596759
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||| |||||||||||||||| |
|
|
| T |
42596814 |
taaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctgtaa |
42596759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 1286682 - 1286740
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
1286682 |
ggctaaaatatggtgttggtccctacaaatatgcctcgttttggttttagtccctgtaa |
1286740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 2032940 - 2032882
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
2032940 |
ggctaaattatggttttagtccctgcaaatatgtctcgttttggttttagtccatgtaa |
2032882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 281 - 339
Target Start/End: Original strand, 12144906 - 12144964
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
339 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| ||| |||||||||||||||||||| |
|
|
| T |
12144906 |
aggctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccctgta |
12144964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 20661311 - 20661253
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| || ||||||||||||||||||||| |
|
|
| T |
20661311 |
ggctaaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtccctgtaa |
20661253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 26133183 - 26133241
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
26133183 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctgtaa |
26133241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 28871711 - 28871753
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28871711 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
28871753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 283 - 337
Target Start/End: Original strand, 29172524 - 29172578
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
29172524 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29172578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 279 - 332
Target Start/End: Original strand, 4203453 - 4203506
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
4203453 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
4203506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 10408926 - 10408983
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
10408926 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
10408983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 13990898 - 13990837
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
13990898 |
taaggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
13990837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 279 - 340
Target Start/End: Original strand, 20416357 - 20416418
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||||| |||||| |||| |
|
|
| T |
20416357 |
taaggctaaaatatggttttcgtccctgcaaatatgtctcgctttggtttaagtcccggtaa |
20416418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 286 - 343
Target Start/End: Original strand, 32888691 - 32888748
Alignment:
| Q |
286 |
aaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||| ||||||||||||||||||| |
|
|
| T |
32888691 |
aaaatatggttttggtccctgcaaatattcctcgttttcgttttagtccctgtaattt |
32888748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 9179922 - 9179862
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
9179922 |
aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttattccctgtaa |
9179862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 277 - 337
Target Start/End: Complemental strand, 29151856 - 29151796
Alignment:
| Q |
277 |
tataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||| ||| ||||||||||||| |||| |
|
|
| T |
29151856 |
tataaggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagttcctg |
29151796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 35166159 - 35166103
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||| ||||||||||| ||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
35166159 |
aggctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtccctg |
35166103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 284 - 340
Target Start/End: Complemental strand, 38452394 - 38452338
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| ||||| || |||||| |
|
|
| T |
38452394 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgattttaatctctgtaa |
38452338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 279 - 343
Target Start/End: Original strand, 42596450 - 42596514
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||| ||| ||||||||||||| |||||||||| |
|
|
| T |
42596450 |
taaggctaaaatatggttttgatcccagcaaatatatcttgttttggttttagttcctgtaattt |
42596514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 3851330 - 3851271
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||| ||||| ||||||||||||||| |
|
|
| T |
3851330 |
aggctaaaatatggttttagtccctcaaaatatgtctcgttttgattttagtccctgtaa |
3851271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 5904007 - 5904066
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
5904007 |
aggctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagtccctgtaa |
5904066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 6118499 - 6118444
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||| |||||| |
|
|
| T |
6118499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
6118444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 9179592 - 9179651
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| || ||||||||||||||||||||| |
|
|
| T |
9179592 |
aggctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctgtaa |
9179651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 274 - 337
Target Start/End: Original strand, 11799121 - 11799184
Alignment:
| Q |
274 |
atttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||| | |||||||||||||||||| |
|
|
| T |
11799121 |
atttagaaggctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtccctg |
11799184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 17070864 - 17070805
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||| |||| ||||||| |||||||| |
|
|
| T |
17070864 |
aggctaaaatatggttttagtccctacaaatatgtctcgttttcgttttagaccctgtaa |
17070805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 282 - 337
Target Start/End: Complemental strand, 18633961 - 18633906
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||| |||||| |
|
|
| T |
18633961 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttactccctg |
18633906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 277 - 340
Target Start/End: Complemental strand, 21050918 - 21050855
Alignment:
| Q |
277 |
tataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
21050918 |
tatatggctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtccctgtaa |
21050855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 25561705 - 25561760
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || |||||||||||||||||| |
|
|
| T |
25561705 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
25561760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 278 - 337
Target Start/End: Original strand, 29875396 - 29875455
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
29875396 |
ataaggctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccctg |
29875455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 34125306 - 34125365
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
34125306 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
34125365 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 1381538 - 1381496
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1381538 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
1381496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 6912571 - 6912613
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6912571 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
6912613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 283 - 340
Target Start/End: Complemental strand, 9588611 - 9588553
Alignment:
| Q |
283 |
gctaaaatatggtttt-ggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
9588611 |
gctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtccatgtaa |
9588553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 281 - 343
Target Start/End: Original strand, 10830528 - 10830590
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||| || |||||||| || ||||||||||||| |||||||||| |
|
|
| T |
10830528 |
aggctaaaatatggttttggtctcttcaaatatgcctagttttggttttagttcctgtaattt |
10830590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 279 - 337
Target Start/End: Original strand, 15635373 - 15635431
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||| |||||||||||||| |||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
15635373 |
taaggataaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccctg |
15635431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 19565758 - 19565716
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19565758 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
19565716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 24443453 - 24443495
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
24443453 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
24443495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 35876761 - 35876803
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35876761 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
35876803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 35928137 - 35928179
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35928137 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
35928179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 332
Target Start/End: Original strand, 36973353 - 36973403
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| ||||||||||||| |
|
|
| T |
36973353 |
ggctaaaatatggttttggtctctccaaatatgtctcgttttggttttagt |
36973403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 37271633 - 37271591
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37271633 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
37271591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 332
Target Start/End: Original strand, 38962806 - 38962856
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||| ||||||||||||| |
|
|
| T |
38962806 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt |
38962856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 281 - 343
Target Start/End: Original strand, 40038493 - 40038555
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||| ||||| ||||| ||| |||||||| |
|
|
| T |
40038493 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttgattttaatccgtgtaattt |
40038555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 40038858 - 40038800
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || ||||||||||| ||||||||| |
|
|
| T |
40038858 |
ggctaaaatatgattttggtccctgcaaatatgccttgttttggttttaatccctgtaa |
40038800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 40764488 - 40764530
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40764488 |
ttttggtccctgcaaatatgtctcattttggttttggtccctg |
40764530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 285 - 330
Target Start/End: Complemental strand, 45501 - 45456
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggtttta |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggtttta |
45456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 284 - 329
Target Start/End: Complemental strand, 12145181 - 12145136
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
12145181 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
12145136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 284 - 333
Target Start/End: Original strand, 16616370 - 16616419
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| ||||||||| |
|
|
| T |
16616370 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtc |
16616419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 279 - 340
Target Start/End: Original strand, 20683744 - 20683805
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| || ||||| ||||||||||||||| |
|
|
| T |
20683744 |
taaggctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtccctgtaa |
20683805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 281 - 330
Target Start/End: Complemental strand, 25562000 - 25561951
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
330 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
25562000 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25561951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 281 - 334
Target Start/End: Complemental strand, 39379611 - 39379558
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || ||||||||||||||| |
|
|
| T |
39379611 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
39379558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 9532537 - 9532477
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| |||||||||||||| |||| |||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
9532537 |
aaggttaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccttgtaa |
9532477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 281 - 333
Target Start/End: Complemental strand, 10409327 - 10409275
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||| |||||||| |
|
|
| T |
10409327 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
10409275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 284 - 340
Target Start/End: Complemental strand, 16038738 - 16038682
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||| |||| ||||||||||||||| ||| |||||||||||||| |||||| |
|
|
| T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtctctgtaa |
16038682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 282 - 334
Target Start/End: Complemental strand, 23382297 - 23382245
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || ||||||||||||||| |
|
|
| T |
23382297 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
23382245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 284 - 336
Target Start/End: Complemental strand, 27850372 - 27850320
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||| |||| ||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
27850372 |
ctaaaatatgattttagtctctgcaaatatgtctcgttttggttttagtccct |
27850320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 27916766 - 27916706
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||| ||| |||||||||||||| |||||| |
|
|
| T |
27916766 |
aaggttaaaatatggttttattccctgcaaatatgcctcgttttggttttagtctctgtaa |
27916706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 29693092 - 29693032
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| || ||||||||||||||| ||||| |
|
|
| T |
29693092 |
aaggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtccttgtaa |
29693032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 279 - 331
Target Start/End: Original strand, 35166908 - 35166960
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttag |
331 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| || |||||||||||| |
|
|
| T |
35166908 |
taaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttag |
35166960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 328
Target Start/End: Complemental strand, 38182089 - 38182041
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttt |
328 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
38182089 |
aaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38182041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 328
Target Start/End: Original strand, 38189042 - 38189090
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttt |
328 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
38189042 |
aaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38189090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 328
Target Start/End: Complemental strand, 38209315 - 38209267
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttt |
328 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
38209315 |
aaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38209267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 328
Target Start/End: Original strand, 38216267 - 38216315
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttt |
328 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
38216267 |
aaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38216315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 38554750 - 38554807
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||| |||||||||||||| |||||| |
|
|
| T |
38554750 |
aggctaaaatatggttttgatccctgcaaata--tctcgttttggttttagtctctgtaa |
38554807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 285 - 337
Target Start/End: Original strand, 39379242 - 39379294
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||| |||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
39379242 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
39379294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 295 - 338
Target Start/End: Complemental strand, 1286974 - 1286931
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
1286974 |
ttttggtccctgcaaatatgcctcattttggttttggtccctgt |
1286931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 3850299 - 3850358
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttgg-ttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| |||||||||||| || ||| |||||| ||||||||||||||| |
|
|
| T |
3850299 |
ggctaaaatatggttttagtccctgcaaatctgcctcgttttggtttttagtccctgtaa |
3850358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 22540096 - 22540155
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| || ||||||| |||||||||||||||||| |||||| | ||||||| |
|
|
| T |
22540096 |
aggctaaaatatgattatggtccccgcaaatatgtctcatttttgttttaattcctgtaa |
22540155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 285 - 340
Target Start/End: Original strand, 28871640 - 28871695
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||| ||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
28871640 |
taaaatatgattttggtccctgcaaatatccttcgttttggttttagtccctgtaa |
28871695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 29151516 - 29151571
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||| |||||||||||| |
|
|
| T |
29151516 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctg |
29151571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 329
Target Start/End: Complemental strand, 45430 - 45396
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
45430 |
ttttggtccctgcaaatatgtctcattttggtttt |
45396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 1105075 - 1105033
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
1105075 |
ttttggtccctgcaaatatgcctcattttggttttggtccctg |
1105033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 281 - 334
Target Start/End: Complemental strand, 10830898 - 10830844
Alignment:
| Q |
281 |
aggctaaaatatggtttt-ggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||| || |||||||||||||||| |
|
|
| T |
10830898 |
aggctaaaatatgatttttggtccctgcaaatatgccttattttggttttagtcc |
10830844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 278 - 332
Target Start/End: Complemental strand, 18286745 - 18286691
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||| ||| ||||||||||||| |
|
|
| T |
18286745 |
ataaggctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagt |
18286691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 284 - 342
Target Start/End: Complemental strand, 20691094 - 20691036
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaatt |
342 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| ||| |||||||||||||| ||||||| |
|
|
| T |
20691094 |
ctaaaatatgattttggttcctgcaaatatggctcgttttggttttagtctttgtaatt |
20691036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 329
Target Start/End: Original strand, 20985798 - 20985832
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
20985798 |
ttttggtccctgcaaatatgtctcattttggtttt |
20985832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #172
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 333
Target Start/End: Original strand, 31602221 - 31602259
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31602221 |
ttttggtccctgcaaatatgtctcgttttggttttagtc |
31602259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #173
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 281 - 326
Target Start/End: Original strand, 4736204 - 4736249
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggt |
326 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
4736204 |
aggctaaaatatggttttggtctttgcaaatatgtctcgttttggt |
4736249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #174
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 27916462 - 27916519
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||| | || || ||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
27916462 |
gctaaaatatgatcttagttcctgcaaatatgtttcgttttggttttagtccctgtaa |
27916519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #175
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 273 - 337
Target Start/End: Complemental strand, 31541690 - 31541626
Alignment:
| Q |
273 |
aatttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||| |||||||||||| ||||| ||||||||||||| | ||||||||||| ||||||| |
|
|
| T |
31541690 |
aatttatatggctaaaatatgtttttgatccctgcaaatataacgaattttggtttttgtccctg |
31541626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #176
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 282 - 330
Target Start/End: Original strand, 42994068 - 42994116
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
330 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||| ||||| |
|
|
| T |
42994068 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttgatttta |
42994116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #177
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 5917387 - 5917344
Alignment:
| Q |
295 |
ttttggtccctgcaaa-tatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
5917387 |
ttttggtccctgcaaaatatgtctcattttggttttggtccctg |
5917344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #178
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 300 - 343
Target Start/End: Original strand, 5933141 - 5933184
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
5933141 |
gtccctgcaaatatgtgacattttggttttagtccctgcaattt |
5933184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #179
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 282 - 313
Target Start/End: Original strand, 9588358 - 9588389
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9588358 |
ggctaaaatatggttttggtccctgcaaatat |
9588389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #180
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 285 - 340
Target Start/End: Original strand, 18286431 - 18286486
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| || ||||||||||||||| ||||||||||| ||| ||||| |
|
|
| T |
18286431 |
taaaatatggttttagttcctgcaaatatgtcttgttttggttttaatccttgtaa |
18286486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #181
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 285 - 340
Target Start/End: Complemental strand, 20418013 - 20417958
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||| ||||| |||||||||| |||| |
|
|
| T |
20418013 |
taaaatatggtttaagtctctgcaaatatgtctcgttttgattttagtccccgtaa |
20417958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #182
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 32109097 - 32109039
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||| ||||| |||||||| ||||||||||| || ||||||||||||||||||||| |
|
|
| T |
32109097 |
aggctaatatatgattttggtcg-tgcaaatatgtttcgttttggttttagtccctgtaa |
32109039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #183
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 279 - 338
Target Start/End: Complemental strand, 42207575 - 42207517
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
|||| ||||||||||||||| |||| | |||||||| ||| ||||||||||||||||||| |
|
|
| T |
42207575 |
taagcctaaaatatggttttagtcc-tacaaatatgcctcgttttggttttagtccctgt |
42207517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #184
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 2636742 - 2636784
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| ||||||| |
|
|
| T |
2636742 |
ttttggtccctgcaaatatgccttattttggttttggtccctg |
2636784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #185
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 4736469 - 4736427
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||| ||||||| |
|
|
| T |
4736469 |
ttttggtctctgcaaatatgcctcattttggtttttgtccctg |
4736427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #186
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 284 - 322
Target Start/End: Complemental strand, 6244439 - 6244401
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattt |
322 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
6244439 |
ctaaaatatgattttggtccctgcaaatatgactcattt |
6244401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #187
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 329
Target Start/End: Original strand, 18258236 - 18258270
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
18258236 |
ttttggcccctgcaaatatgtctcattttggtttt |
18258270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #188
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 303 - 337
Target Start/End: Original strand, 19685097 - 19685131
Alignment:
| Q |
303 |
cctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19685097 |
cctgcaaatatgtctcattttggttttggtccctg |
19685131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #189
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 21050575 - 21050633
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| |||| |||||| |||||||| || ||||| ||||||||||||||| |
|
|
| T |
21050575 |
ggctaaaatatgattttagtccctacaaatatgcttcgttttgattttagtccctgtaa |
21050633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #190
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 329
Target Start/End: Original strand, 32108880 - 32108914
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggtttt |
329 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
32108880 |
ttttggtccctgcaaatatgcctcattttggtttt |
32108914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #191
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 280 - 313
Target Start/End: Original strand, 3936576 - 3936609
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
3936576 |
aaggctaaaatatgtttttggtccctgcaaatat |
3936609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #192
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 276 - 337
Target Start/End: Original strand, 3954046 - 3954107
Alignment:
| Q |
276 |
ttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||| ||||||||||||| ||||||||| ||||||||| || |||| |||||| ||||||| |
|
|
| T |
3954046 |
ttattaggctaaaatatgtttttggtccttgcaaatatatcgaatttgggttttggtccctg |
3954107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #193
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 280 - 313
Target Start/End: Complemental strand, 27571190 - 27571157
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
27571190 |
aaggctaaaatatgattttggtccctgcaaatat |
27571157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #194
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 279 - 340
Target Start/End: Original strand, 31037392 - 31037453
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||| || ||||| |||||||| |||||| |
|
|
| T |
31037392 |
taagactaaaatatggttttagtccctgcaaatataccttgttttgattttagtctctgtaa |
31037453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #195
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 280 - 313
Target Start/End: Complemental strand, 34911889 - 34911856
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
34911889 |
aaggctaaaatatgattttggtccctgcaaatat |
34911856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #196
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 295 - 336
Target Start/End: Original strand, 36973426 - 36973467
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| |||||| |
|
|
| T |
36973426 |
ttttggtccctgcaaatatgcctcattttgattttggtccct |
36973467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #197
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 334
Target Start/End: Original strand, 38496419 - 38496471
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||| ||||| |||| || |||||||||| |||||||||||||||| |
|
|
| T |
38496419 |
aggctaaaatatagttttagtccttgtaaatatgtct-attttggttttagtcc |
38496471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #198
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 300 - 340
Target Start/End: Complemental strand, 6497559 - 6497519
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
6497559 |
gtccctgcaaatatctgacattttggttttagtccctgtaa |
6497519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #199
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 283 - 343
Target Start/End: Complemental strand, 11935967 - 11935907
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| | ||||| |||||| ||||| |||||| |
|
|
| T |
11935967 |
gctaaaatatgattttggtctctgcaaatatgctttattttcgttttaatccctataattt |
11935907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #200
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 300 - 340
Target Start/End: Original strand, 22394140 - 22394180
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
22394140 |
gtccctgcaaatatctgacattttggttttagtccctgtaa |
22394180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #201
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 283 - 339
Target Start/End: Complemental strand, 22551318 - 22551262
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgta |
339 |
Q |
| |
|
|||||||||||||||| ||| ||| |||||||| | |||||||||||||| ||||| |
|
|
| T |
22551318 |
gctaaaatatggttttagtctctgtaaatatgttttgttttggttttagtctctgta |
22551262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #202
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 300 - 340
Target Start/End: Original strand, 24490860 - 24490900
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
24490860 |
gtccctgcaaatatctgacattttggttttagtccctgtaa |
24490900 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #203
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 313
Target Start/End: Original strand, 31540495 - 31540527
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
31540495 |
aggctaaaatatgtttttggtccctgcaaatat |
31540527 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #204
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 39808084 - 39808144
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||| | | ||||||||||| ||||| | ||||| ||||||| |
|
|
| T |
39808084 |
aaggctaaaatatggttttggtttccgtaaatatgtctctttttgatcttagttcctgtaa |
39808144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 56; Significance: 4e-23; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 15013 - 14954
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15013 |
aggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctgtaa |
14954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 281 - 338
Target Start/End: Original strand, 14696 - 14753
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
14696 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgt |
14753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 56; Significance: 4e-23; HSPs: 3)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 27365 - 27306
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27365 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
27306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 281 - 343
Target Start/End: Original strand, 26999 - 27060
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||| |||| |||||| ||| |||||||| |
|
|
| T |
26999 |
aggctcaaatttggttttggtccctgcaaatatgtctcgtttt-gttttaatccttgtaattt |
27060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 27072 - 27114
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
27072 |
ttttggtccctgcaaatatgcctcgttttggttttggtccctg |
27114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 55; Significance: 1e-22; HSPs: 3)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 148282 - 148224
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
148282 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgtaa |
148224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 147960 - 148002
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||| ||||||| |
|
|
| T |
147960 |
ttttggtcccagcaaatatgcctcattttggttttggtccctg |
148002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 280 - 336
Target Start/End: Original strand, 147888 - 147941
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||| |||| |||||||||||| |
|
|
| T |
147888 |
aaggctaaaatatggtttt-gtccctgcaaata--tctcgttttagttttagtccct |
147941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 54; Significance: 6e-22; HSPs: 5)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 47923 - 47980
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47923 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
47980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 285 - 343
Target Start/End: Complemental strand, 48228 - 48170
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtctctgtaattt |
48170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 281 - 334
Target Start/End: Complemental strand, 223173 - 223120
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
223173 |
aggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
223120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 295 - 336
Target Start/End: Original strand, 222884 - 222925
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
222884 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
222925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 343
Target Start/End: Original strand, 222817 - 222874
Alignment:
| Q |
286 |
aaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||| |||| |||||| ||||||| ||| ||||||||||||| |||||||||| |
|
|
| T |
222817 |
aaaatatgattttagtccctccaaatatttcttgttttggttttagttcctgtaattt |
222874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 277 - 337
Target Start/End: Complemental strand, 294 - 234
Alignment:
| Q |
277 |
tataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
294 |
tataaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 52; Significance: 9e-21; HSPs: 3)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 274 - 337
Target Start/End: Original strand, 82333 - 82396
Alignment:
| Q |
274 |
atttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
82333 |
atttttaaggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctg |
82396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 82707 - 82648
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
82707 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgtaa |
82648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 82414 - 82456
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| ||||||| |
|
|
| T |
82414 |
ttttggtccctgcaaatatgccttattttggttttggtccctg |
82456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 52; Significance: 9e-21; HSPs: 3)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 75358 - 75417
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
75358 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctgtaa |
75417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 281 - 337
Target Start/End: Complemental strand, 75765 - 75709
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
75765 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
75709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 75691 - 75649
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| ||||||| |
|
|
| T |
75691 |
ttttggtccctgcaaatatgtctcttttttgttttggtccctg |
75649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 278 - 340
Target Start/End: Original strand, 2774 - 2836
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
2774 |
ataaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
2836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 280 - 337
Target Start/End: Original strand, 1309 - 1366
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1309 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
1366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 280 - 337
Target Start/End: Complemental strand, 1646 - 1589
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
1646 |
aaggctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccctg |
1589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 282 - 343
Target Start/End: Original strand, 16724 - 16785
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
16724 |
ggctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtccctgtaattt |
16785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 16796 - 16838
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
16796 |
tttttgtcactgcaaatatgtctcattttggttttggtccctg |
16838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 279 - 340
Target Start/End: Complemental strand, 366276 - 366215
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
366276 |
taaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
366215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 365979 - 366037
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
365979 |
ggctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctgtaa |
366037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 49; Significance: 5e-19; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 275 - 343
Target Start/End: Complemental strand, 8649 - 8581
Alignment:
| Q |
275 |
tttataaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
8649 |
tttaaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaattt |
8581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 8328 - 8388
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||| ||||||||| ||||| |
|
|
| T |
8328 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccttgtaa |
8388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 49; Significance: 5e-19; HSPs: 5)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 285 - 337
Target Start/End: Complemental strand, 50075 - 50023
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
50023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 285 - 337
Target Start/End: Complemental strand, 55176 - 55124
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
55124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 54813 - 54873
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
54813 |
aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgtaa |
54873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 50005 - 49963
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
50005 |
ttttggtccttgcaaatatgtctcattttggttttggtccctg |
49963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 295 - 337
Target Start/End: Complemental strand, 55106 - 55064
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
55106 |
ttttggtccttgcaaatatgtctcattttggttttggtccctg |
55064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 3292 - 3233
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3292 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctgtaa |
3233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 47; Significance: 9e-18; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 9028 - 8970
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
9028 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
8970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 284 - 340
Target Start/End: Original strand, 8734 - 8790
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgtaa |
8790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 47; Significance: 9e-18; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 12525 - 12583
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
12525 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
12583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 47; Significance: 9e-18; HSPs: 2)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 281 - 343
Target Start/End: Complemental strand, 35085 - 35023
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35085 |
aggctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtccctgtaattt |
35023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 285 - 343
Target Start/End: Original strand, 34724 - 34782
Alignment:
| Q |
285 |
taaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||| | |||||||||||| |||||||| ||||| | |||||||||| |
|
|
| T |
34724 |
taaaatatggttttgtttcctgcaaatatgcttcattttgattttaattcctgtaattt |
34782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 47; Significance: 9e-18; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 3532 - 3590
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
3532 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgtaa |
3590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 3920 - 3860
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
3920 |
aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctgtaa |
3860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 47; Significance: 9e-18; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 279 - 337
Target Start/End: Complemental strand, 5711 - 5653
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5711 |
taaggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
5653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 265 - 333
Target Start/End: Original strand, 5380 - 5450
Alignment:
| Q |
265 |
attgattaaatttat--aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||| ||||||||||||||| || |||||||||||||| |
|
|
| T |
5380 |
attgattaaattaattaaaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
5450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 46; Significance: 3e-17; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 281 - 334
Target Start/End: Original strand, 4040 - 4093
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4040 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
4093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 281 - 334
Target Start/End: Original strand, 19222 - 19275
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
19222 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
19275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 280 - 334
Target Start/End: Complemental strand, 4290 - 4236
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
4290 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
4236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 280 - 334
Target Start/End: Complemental strand, 19472 - 19418
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
19472 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
19418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 281 - 338
Target Start/End: Original strand, 24371 - 24428
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgt |
338 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
24371 |
aggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctgt |
24428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 282 - 343
Target Start/End: Complemental strand, 2883 - 2822
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |||||| |
|
|
| T |
2883 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttgagtttagtccctataattt |
2822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 281 - 343
Target Start/End: Original strand, 2500 - 2562
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| || ||||| ||||||||||| |||||| |
|
|
| T |
2500 |
aggctaaaatatggttttgatccctgcaaatatgcttcgttttgattttagtccctataattt |
2562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 5207 - 5267
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
5207 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaa |
5267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 280 - 340
Target Start/End: Original strand, 5227 - 5287
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
5227 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctgtaa |
5287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 45; Significance: 1e-16; HSPs: 3)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 279 - 343
Target Start/End: Complemental strand, 22058 - 21994
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| || ||| ||||||||||||||| |||||||| |
|
|
| T |
22058 |
taaggctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagtccttgtaattt |
21994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 295 - 336
Target Start/End: Original strand, 21763 - 21804
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
21763 |
ttttggtccctgcaaatatgtctcgttttggttttggtccct |
21804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 280 - 315
Target Start/End: Original strand, 21694 - 21729
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgt |
315 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
21694 |
aaggctaaaatatggttttgatccctgcaaatatgt |
21729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 44; Significance: 5e-16; HSPs: 2)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 336
Target Start/End: Complemental strand, 2661 - 2606
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccct |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
2661 |
aggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccct |
2606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 281 - 330
Target Start/End: Original strand, 2333 - 2382
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
330 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
2333 |
aggctataatatggttttggtccctgcaaatattccttgttttggtttta |
2382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 44; Significance: 5e-16; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 10516 - 10457
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
10516 |
aggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctgtaa |
10457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 282 - 334
Target Start/End: Original strand, 10168 - 10220
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
334 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| || ||||||||||||||| |
|
|
| T |
10168 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
10220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 279 - 337
Target Start/End: Original strand, 8544 - 8602
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
8544 |
taaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
8602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 282 - 340
Target Start/End: Original strand, 12182 - 12240
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| |||| |||||||||||||||| |
|
|
| T |
12182 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctgtaa |
12240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 12536 - 12478
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
12536 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccttgtaa |
12478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 3)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 281 - 333
Target Start/End: Complemental strand, 4080 - 4028
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
333 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
4080 |
aggctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagtc |
4028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 3751 - 3810
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||||| ||||||||| |
|
|
| T |
3751 |
aggctaaaatatggttttggtccctgcaaatatgctttgttttggttttaatccctgtaa |
3810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 295 - 337
Target Start/End: Original strand, 3824 - 3866
Alignment:
| Q |
295 |
ttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||| ||||||| |
|
|
| T |
3824 |
ttttggtccatgcaaatatgtctcattttgattttggtccctg |
3866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 282 - 337
Target Start/End: Original strand, 34931 - 34986
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||||||| || ||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
34931 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg |
34986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Complemental strand, 18044 - 17985
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||| ||| |||||| |||||||||||||| |
|
|
| T |
18044 |
aggctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctgtaa |
17985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 4)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 281 - 340
Target Start/End: Original strand, 94056 - 94115
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
94056 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatccctgtaa |
94115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 283 - 330
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
330 |
Q |
| |
|
|||||||||||||||| |||||| |||||||| ||| ||||||||||| |
|
|
| T |
94329 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 313
Target Start/End: Complemental strand, 345957 - 345925
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
345957 |
aggctaaaatatgtttttggtccctgcaaatat |
345925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 313
Target Start/End: Complemental strand, 376429 - 376397
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
376429 |
aggctaaaatatgcttttggtccctgcaaatat |
376397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 4312 - 4254
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||||||||| ||||| ||||| |
|
|
| T |
4312 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttgagtccttgtaa |
4254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 289 - 337
Target Start/End: Original strand, 4016 - 4064
Alignment:
| Q |
289 |
atatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
337 |
Q |
| |
|
|||||||||| |||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
4016 |
atatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
4064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 2)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 282 - 340
Target Start/End: Complemental strand, 17966 - 17908
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||| ||| ||||| ||||||||||| |
|
|
| T |
17966 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctgtaa |
17908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 17651 - 17708
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||| |||| ||||| ||||||||||| |||| |||||||||||||||| |
|
|
| T |
17651 |
gctaaaatatgattttaatccctacaaatatgtcttgttttagttttagtccctgtaa |
17708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 280 - 341
Target Start/End: Complemental strand, 189680 - 189619
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaat |
341 |
Q |
| |
|
||||||||||||| ||||| ||| ||||||||||| ||||||||||||||| || ||||||| |
|
|
| T |
189680 |
aaggctaaaatatagtttttgtcgctgcaaatatgcctcattttggttttaatctctgtaat |
189619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 343
Target Start/End: Original strand, 61630 - 61693
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctca-ttttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| | || ||||| |||||||||||| ||||| |
|
|
| T |
61630 |
aaggctaaaatatggtattggtccctgcaaatatg-cacagttttgattttagtccctgcaattt |
61693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0578 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: scaffold0578
Description:
Target: scaffold0578; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 280 - 332
Target Start/End: Complemental strand, 5072 - 5020
Alignment:
| Q |
280 |
aaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||| |||| ||||||||||||| |
|
|
| T |
5072 |
aaggttaaaatatggttttggtctctgcaaatatatctcgttttggttttagt |
5020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 282 - 330
Target Start/End: Complemental strand, 44206 - 44158
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
330 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
44206 |
ggctaaaatatggctttggtccctgcaaatatgcttcattttggtttta |
44158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0472 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: scaffold0472
Description:
Target: scaffold0472; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 279 - 330
Target Start/End: Complemental strand, 7267 - 7216
Alignment:
| Q |
279 |
taaggctaaaatatggttttggtccctgcaaatatgtctcattttggtttta |
330 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
7267 |
taaggctaaaatatgattttggtctctgcaaatatgtcttgttttggtttta |
7216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0472; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 6947 - 7004
Alignment:
| Q |
283 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
||||||||||| ||||| ||| || |||||||||||||||| |||||| ||||||||| |
|
|
| T |
6947 |
gctaaaatatgattttgatccttgtaaatatgtctcattttagttttaatccctgtaa |
7004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0204 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 284 - 343
Target Start/End: Original strand, 17126 - 17185
Alignment:
| Q |
284 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgtaattt |
343 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| | ||||||||||||| ||| |||||| |
|
|
| T |
17126 |
ctaaaatatggttttggtccctccaaatatgtttggttttggttttagttcctctaattt |
17185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 282 - 332
Target Start/End: Complemental strand, 3455 - 3405
Alignment:
| Q |
282 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagt |
332 |
Q |
| |
|
||||||||||| ||||| || |||||||||||||||| ||||||||||||| |
|
|
| T |
3455 |
ggctaaaatatagttttagttcctgcaaatatgtctcgttttggttttagt |
3405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0106 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0106
Description:
Target: scaffold0106; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 281 - 313
Target Start/End: Complemental strand, 30967 - 30935
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
30967 |
aggctaaaatatggttttggtccctgcaaatat |
30935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0517 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0517
Description:
Target: scaffold0517; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 278 - 313
Target Start/End: Complemental strand, 11585 - 11550
Alignment:
| Q |
278 |
ataaggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11585 |
ataaggctaaaatatgtttttggtccctgcaaatat |
11550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0817 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0817
Description:
Target: scaffold0817; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 300 - 340
Target Start/End: Complemental strand, 4349 - 4309
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
4349 |
gtccctgcaaatatctgacattttggttttagtccctgtaa |
4309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0103 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0103
Description:
Target: scaffold0103; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 300 - 340
Target Start/End: Original strand, 43293 - 43333
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
43293 |
gtccctgcaaatatttgacattttggttttagtccctgtaa |
43333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 300 - 340
Target Start/End: Complemental strand, 44035 - 43995
Alignment:
| Q |
300 |
gtccctgcaaatatgtctcattttggttttagtccctgtaa |
340 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
44035 |
gtccctgcaaatatttgacattttggttttagtccctgtaa |
43995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 281 - 313
Target Start/End: Original strand, 202578 - 202610
Alignment:
| Q |
281 |
aggctaaaatatggttttggtccctgcaaatat |
313 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
202578 |
aggctaaaatatgcttttggtccctgcaaatat |
202610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University