View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18377_low_12 (Length: 209)

Name: NF18377_low_12
Description: NF18377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18377_low_12
NF18377_low_12
[»] chr3 (1 HSPs)
chr3 (18-148)||(12364942-12365072)


Alignment Details
Target: chr3 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 18 - 148
Target Start/End: Original strand, 12364942 - 12365072
Alignment:
Q  18 gttaatcctgatggtaaaaccattactagctcatgcctccatcattaagaattttcctcaagggataaattcttcatgctcactatcccaactcaaagaa 117  Q
    ||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||  |||||||||| ||||||||||||||||||||||||||||    
T  12364942 gttaatcctcatggtaaaaccattaccagctcatgcctccatcattaagaattttcctcctgggataaatttttcatgctcactatcccaactcaaagaa 12365041  T
Q  118 tatgctagaaacaacctttattcctttatgg 148  Q
    ||||| ||||||||||||| || ||||||||    
T  12365042 tatgccagaaacaaccttttttactttatgg 12365072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University