View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18374_low_41 (Length: 226)

Name: NF18374_low_41
Description: NF18374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18374_low_41
NF18374_low_41
[»] chr7 (1 HSPs)
chr7 (36-226)||(43724235-43724426)


Alignment Details
Target: chr7 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 36 - 226
Target Start/End: Original strand, 43724235 - 43724426
Alignment:
Q  36 atagagtacctaaaaccgtacccattcatgggtcacatgaattattctgtagtgttgctataatttattactcnnnnnnnnnnnnnnnn-aacaaggagt 134  Q
    |||| |||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||                 ||||||||||    
T  43724235 atagggtacctaaaaccatacccatccatgggtcacatgaattattctgtagtgttgctataatttattactctctttttgtttttttttaacaaggagt 43724334  T
Q  135 tcttaaattatatagaaaataaatcaattcaacatataataacattttttaaacccatagcaaataattcattggtaaacaatttgaataac 226  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43724335 tcttaaattatatagaaaataaatcaattcaacatattataacattttttaaacccatagcaaataattcattggtaaacaatttgaataac 43724426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University