View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18374_high_45 (Length: 209)

Name: NF18374_high_45
Description: NF18374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18374_high_45
NF18374_high_45
[»] chr7 (1 HSPs)
chr7 (11-187)||(18498604-18498780)


Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 11 - 187
Target Start/End: Original strand, 18498604 - 18498780
Alignment:
Q  11 aggagcacagaggcttcaatctaaaatctagagatttagattgggtagatttccactcaactcgctaacattaggagcttaagaagagaagtgtgcaaga 110  Q
    |||| ||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  18498604 aggaacaccgaggcttcattctaaaatctagagatttagattgggtagatttccactcaactcgctaacattgggagcttaagaagagaagtgtgcaaga 18498703  T
Q  111 tggttgtagatggaaagcttggtcaggaagtaaccgatggaaaaggtcagtggtaagccaaagcagcaggttagtga 187  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  18498704 tggttgtagatggaaagcttggtcaggaagtaaccgatggaaaaggtcagtggtaagccaaagcagcaggttagtga 18498780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University