View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1836_high_117 (Length: 223)

Name: NF1836_high_117
Description: NF1836
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1836_high_117
NF1836_high_117
[»] chr3 (1 HSPs)
chr3 (1-222)||(38623100-38623321)


Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 38623321 - 38623100
Alignment:
Q  1 ataactcatttcattcttcttgtttatgttaatccattgctatgatgagagaaaaactgaaaattaatactcatccttgaatcaacaaaagctaatgtaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38623321 ataactcatttcattcttcttgtttatgttaatccattgctatgatgagagaaaaactgaaaattaatactcatccttgaatcaacaaaagctaatgtaa 38623222  T
Q  101 agtttgtgtattgattacatatacatcaactttgatttaaaattggaaggatccaatatgtttaccaaccccaaaaactagatagatagggagagataaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |    
T  38623221 agtttgtgtattgattacatatacatcaactttgatttaaaattggaaggatccaatatgtttaccaaccccaaaaactagatagataggtagagataga 38623122  T
Q  201 tagtaatcaatttcagtgccaa 222  Q
    ||||||||||||||||||||||    
T  38623121 tagtaatcaatttcagtgccaa 38623100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University