View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18367_low_18 (Length: 217)

Name: NF18367_low_18
Description: NF18367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18367_low_18
NF18367_low_18
[»] chr5 (1 HSPs)
chr5 (9-195)||(4278882-4279068)


Alignment Details
Target: chr5 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 9 - 195
Target Start/End: Complemental strand, 4279068 - 4278882
Alignment:
Q  9 gtgagatgaaaagtgaatctcatcttgcatataaacttattgtaattgtacgaaacattaatggattgttttctccatagttttaaagccatattggcgc 108  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||    
T  4279068 gtgaaatgaaaagtgaatctcatcttgcatataaacttattgtaattgtacgaaacattaatggattgttttctccatagttttaaagccatgttggtgc 4278969  T
Q  109 atctcttgtttccatgctcatgtgatacaggcttattacgttgctagcaaatattgatttgtgtaggctttatataattttaggcaa 195  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4278968 atctcttgtttccatgctcatgtgatataggcttattacgttgctagcaaatattgatttgtgtaggctttatataattttaggcaa 4278882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University