View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18360_high_10 (Length: 312)

Name: NF18360_high_10
Description: NF18360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18360_high_10
NF18360_high_10
[»] chr7 (2 HSPs)
chr7 (11-134)||(35159737-35159863)
chr7 (208-312)||(35159559-35159663)


Alignment Details
Target: chr7 (Bit Score: 93; Significance: 3e-45; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 11 - 134
Target Start/End: Complemental strand, 35159863 - 35159737
Alignment:
Q  11 cataggttgtcacatgttccgtcataagacacatcaccaccaccggacaaagttgatatgagatttggtgg---tggttcttctcataaaccactaccgc 107  Q
    ||||| ||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||   |||||||||| |||||||||| ||||    
T  35159863 catagattgtcacatgttccgccataagacacatcaccaccacgggacaaagttgatatgagatttggtggtggtggttcttctgataaaccactgccgc 35159764  T
Q  108 tgaatttgatattgattgcataagtaa 134  Q
    |||||||||||||||||||||||||||    
T  35159763 tgaatttgatattgattgcataagtaa 35159737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 208 - 312
Target Start/End: Complemental strand, 35159663 - 35159559
Alignment:
Q  208 aagcacctgagaaaccatgtctcaaatgcatcaaccatcaaactcaataaaccatcacagtaaactatattgttttgggatttagtacatgcttcgagtt 307  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | |||  |||||||||||||||| ||||||||||||||||||    
T  35159663 aagcacgtgagaaaccatgtctcaaatgcatcaaccatcaaactcaataaaccatcaaaataacatatattgttttgggatgtagtacatgcttcgagtt 35159564  T
Q  308 tttct 312  Q
    |||||    
T  35159563 tttct 35159559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University