View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18356_low_23 (Length: 227)

Name: NF18356_low_23
Description: NF18356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18356_low_23
NF18356_low_23
[»] chr8 (2 HSPs)
chr8 (17-153)||(8411001-8411137)
chr8 (176-211)||(8410979-8411014)
[»] chr1 (1 HSPs)
chr1 (17-124)||(20424799-20424906)


Alignment Details
Target: chr8 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 17 - 153
Target Start/End: Complemental strand, 8411137 - 8411001
Alignment:
Q  17 agaaactagtgtactggcaggatatgttattaaccttgagaaagagttgtctactagcatttctgttggagcagctcttgtgcaatcaacacagtttgaa 116  Q
    ||||||||||||||||| |||| ||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  8411137 agaaactagtgtactggtaggagatgttattaaccttgagaaagagttatctactagcatttatgttggagcagctcttgtgcaatcaacacagtttgaa 8411038  T
Q  117 gatgttcatacctcgacgactgaggaacaaagagaaa 153  Q
    |||||||||||||||||||| ||||||||||||||||    
T  8411037 gatgttcatacctcgacgaccgaggaacaaagagaaa 8411001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 176 - 211
Target Start/End: Complemental strand, 8411014 - 8410979
Alignment:
Q  176 ggaacaaagagaaaaccaacaaagtagtaaatttct 211  Q
    |||||||||||||| |||||||||||||||||||||    
T  8411014 ggaacaaagagaaatccaacaaagtagtaaatttct 8410979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 17 - 124
Target Start/End: Original strand, 20424799 - 20424906
Alignment:
Q  17 agaaactagtgtactggcaggatatgttattaaccttgagaaagagttgtctactagcatttctgttggagcagctcttgtgcaatcaacacagtttgaa 116  Q
    ||||||||||| ||||  | || || |||||||| ||||| ||||||||||| ||||||| ||||||||| |||||| | |||||||||||||| |||||    
T  20424799 agaaactagtgcactgataagaaatattattaactttgaggaagagttgtctgctagcatctctgttggaacagctcgtttgcaatcaacacagattgaa 20424898  T
Q  117 gatgttca 124  Q
    ||||||||    
T  20424899 gatgttca 20424906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University