View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18356_low_22 (Length: 231)

Name: NF18356_low_22
Description: NF18356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18356_low_22
NF18356_low_22
[»] chr1 (1 HSPs)
chr1 (18-192)||(37726008-37726182)


Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 18 - 192
Target Start/End: Complemental strand, 37726182 - 37726008
Alignment:
Q  18 aacaagtcagtcaaagttgatttacttgggtaacaagtgtaatcttgtaagtaagttgtctatttagatactctagttaacatcctaggtggcagtagag 117  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37726182 aacaagtcagccaaagttgatttacttgggtaacaagtgtaatcttgtaagtaagttgtctatttagatactctagttaacatcctaggtggcagtagag 37726083  T
Q  118 tgttttatggtttaagtatcatgtggtttatacctttgtatatcccattgagtttcagtaaggcagcaaatatga 192  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37726082 tgttttatggtttaagtatcatgtggtttatacctttgtatatcccattgagtttcagtaaggcagcaaatatga 37726008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University