View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18355_high_25 (Length: 234)

Name: NF18355_high_25
Description: NF18355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18355_high_25
NF18355_high_25
[»] chr7 (1 HSPs)
chr7 (1-213)||(41845518-41845730)


Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 41845518 - 41845730
Alignment:
Q  1 tgcttcaaattaagttctatttaaagccttggccaatccgtaatatgaccactttatttgccttaagatatggcggggttatgattaactatctaaaggc 100  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41845518 tgcttcaaattaagttctatttaaagccttggtcaatccgtaatatgaccactttatttgccttaagatatggcggggttatgattaactatctaaaggc 41845617  T
Q  101 ttttcatgtcaggaataaattgagcatttttggaatttgaccagcaaatatgccccacaggcccacatcatatcattcgcatttactatttgttgcaaaa 200  Q
    ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41845618 ttttcatgtcaagaataaattgagcagttttggaatttgaccagcaaatatgccccacaggcccacatcatatcattcgcatttactatttgttgcaaaa 41845717  T
Q  201 tgattgaatgaat 213  Q
    |||||||||||||    
T  41845718 tgattgaatgaat 41845730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University