View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18352_low_23 (Length: 201)

Name: NF18352_low_23
Description: NF18352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18352_low_23
NF18352_low_23
[»] chr1 (2 HSPs)
chr1 (127-184)||(42396780-42396837)
chr1 (19-53)||(42396672-42396706)


Alignment Details
Target: chr1 (Bit Score: 50; Significance: 8e-20; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 127 - 184
Target Start/End: Original strand, 42396780 - 42396837
Alignment:
Q  127 acagtcattatttttatactctcagtggagaacaactataaatatatgctgcccaaaa 184  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  42396780 acagtcagtatttttatactctcagtggagaacaactataaatatatactgcccaaaa 42396837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 19 - 53
Target Start/End: Original strand, 42396672 - 42396706
Alignment:
Q  19 atacagaacaattatgatgcatattggtttgattc 53  Q
    |||||||||||||||||||||||||||||||||||    
T  42396672 atacagaacaattatgatgcatattggtttgattc 42396706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University