View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1834_high_14 (Length: 236)

Name: NF1834_high_14
Description: NF1834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1834_high_14
NF1834_high_14
[»] chr5 (1 HSPs)
chr5 (20-225)||(23142114-23142319)


Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 20 - 225
Target Start/End: Complemental strand, 23142319 - 23142114
Alignment:
Q  20 ctatgaggccgacacatatttatcggaagatatcttacgatagtgtannnnnnncttctttttgcgtatggcaagatatcttccgatgatgtattttgcc 119  Q
    ||||||||||| |||||||||||||||||||||| ||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||    
T  23142319 ctatgaggccgccacatatttatcggaagatatcctacgatagtgtatttttttattctttttgcgtatggcaagatatcttccgatgatgtattttgcc 23142220  T
Q  120 taaaaatctttatggctggtcgatattaacatactggctcaaagtcatgtttggcgaataggccgcagaaagaacttttctcactactcatactacttca 219  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||    
T  23142219 taaaaatctttatggctggtcgatattaacatactggctcaaagtcatgtttggcgaataggccgcagaaagaacttttcccactactcatattacttca 23142120  T
Q  220 agtata 225  Q
    ||||||    
T  23142119 agtata 23142114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University