View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1833_low_15 (Length: 236)

Name: NF1833_low_15
Description: NF1833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1833_low_15
NF1833_low_15
[»] chr1 (1 HSPs)
chr1 (25-223)||(35481122-35481320)


Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 25 - 223
Target Start/End: Complemental strand, 35481320 - 35481122
Alignment:
Q  25 gggttaaaggattggattaggaattgtagtcaagtgagtttcaatctcttttccctttcttccttacctttgnnnnnnngggtcctgcggaatatggctc 124  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||    
T  35481320 gggttaaaggattggattaggaattgtagtcaagtgagtttcaatctcttttccctttcttccttacctttgtttttttgggtcctgcggaatatggctc 35481221  T
Q  125 tttattaatttgggtttagttgcaatattcttttgctttgcctacttaatagaaggacttgatcatttttgttttctctatagcttgtatgttatcttt 223  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  35481220 tttattaatttgggtttagttgcaatattcttttgctttgcctacttaatagaaggacttgatcatttttgttttctctatagcttgtacgttatcttt 35481122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University