View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18338_low_14 (Length: 240)

Name: NF18338_low_14
Description: NF18338
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18338_low_14
NF18338_low_14
[»] chr5 (1 HSPs)
chr5 (86-240)||(4570258-4570412)


Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 86 - 240
Target Start/End: Complemental strand, 4570412 - 4570258
Alignment:
Q  86 atgtgcatggattggacctggtctaagagtagcagacttgaatattaccattccaagtgccttacgtgatgctaaagtttcaaatttattagatagtaat 185  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  4570412 atgtgcatggattgaacctggtctaagagtagcagacttgaatattaccattccaagtgccttacgtgatgctaaagtttcagatttattagatagtaat 4570313  T
Q  186 ggagcatggaattgggctttgttgaatcattgggtacctgaagacattttggaca 240  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  4570312 ggagcatagaattgggctttgttgaatcattgggtacctgaagacattttggaca 4570258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University