View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18336_low_43 (Length: 229)

Name: NF18336_low_43
Description: NF18336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18336_low_43
NF18336_low_43
[»] chr8 (1 HSPs)
chr8 (16-215)||(2636234-2636433)


Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 16 - 215
Target Start/End: Complemental strand, 2636433 - 2636234
Alignment:
Q  16 atgaatttattaaataagctcgaaatctgcttattatatattattccatagtaattaattgtcttctcaccaaatggaagatatgatcaattcataattt 115  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2636433 atgaatttattaaataagctcgaaatttgcttattatatattattccatagtaattaattgtcttctcaccaaatggaagatatgatcaattcataattt 2636334  T
Q  116 acttcataggcattgaacttgctatacatgaataaaattatagctaggtttannnnnnnnnnnggcaaatagctaggtttagttgtctctgatatatatt 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||            ||||||||||||||||| |||||||| |||||||||    
T  2636333 acttcataggcattgaacttgctatacatgaataaaattatagctaggtttattattttttttagcaaatagctaggtttaattgtctctaatatatatt 2636234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University