View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18336_high_40 (Length: 207)

Name: NF18336_high_40
Description: NF18336
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18336_high_40
NF18336_high_40
[»] chr4 (1 HSPs)
chr4 (1-100)||(21721160-21721259)


Alignment Details
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 21721259 - 21721160
Alignment:
Q  1 aaaatagatagttgattctaaatatctttatatttgtttctttaactagtattcatagatactagttaacatgacccgaacatacgatataatccgagtg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |||  ||||||||    
T  21721259 aaaatagatagttgattctaaatatctttatatttgtttctttaactagtattcagagatactagttaatatgacccgaacatacggtatgttccgagtg 21721160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University