View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18334_high_8 (Length: 250)

Name: NF18334_high_8
Description: NF18334
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18334_high_8
NF18334_high_8
[»] chr1 (2 HSPs)
chr1 (1-166)||(48316825-48316990)
chr1 (193-236)||(48316781-48316823)
[»] chr5 (1 HSPs)
chr5 (1-69)||(251335-251403)


Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 166
Target Start/End: Complemental strand, 48316990 - 48316825
Alignment:
Q  1 tgcagtgatgtttctaataatgacctttgtggaacaataccagtagatggcaactttggatccttcccaataaaaaggtacaacaactttgcctttgaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48316990 tgcagtgatgtttctaataatgacctttgtggaacaataccagtagatggcaactttggatccttcccaataaaaaggtacaacaactttgcctttgaat 48316891  T
Q  101 gcataacaaatgtactcgtatgatgacacaaatattcatatatattgaaactatagcaatttaaat 166  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
T  48316890 gcataacaaatgtactcgtatgatgacacaaatattcataaatattgaaactatagcaatttaaat 48316825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 193 - 236
Target Start/End: Complemental strand, 48316823 - 48316781
Alignment:
Q  193 caaattgtccttttccttttttcagttttgaaaataacggactc 236  Q
    ||||||||||||||||||||| |||||||||||||||| |||||    
T  48316823 caaattgtccttttccttttt-cagttttgaaaataacagactc 48316781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 251335 - 251403
Alignment:
Q  1 tgcagtgatgtttctaataatgacctttgtggaacaataccagtagatggcaactttggatccttccca 69  Q
    |||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||    
T  251335 tgcagtgatgtttccaataatgacctctgtggaacaataccagtagatggcaactttggatctttccca 251403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University