View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18333_low_5 (Length: 254)

Name: NF18333_low_5
Description: NF18333
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18333_low_5
NF18333_low_5
[»] chr4 (1 HSPs)
chr4 (189-240)||(25900368-25900419)
[»] chr3 (1 HSPs)
chr3 (189-240)||(40067818-40067869)


Alignment Details
Target: chr4 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 189 - 240
Target Start/End: Complemental strand, 25900419 - 25900368
Alignment:
Q  189 gagacctgttgtgccatttggtagtgcaagtagaaagcctcatgttgattct 240  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  25900419 gagacctgttgcgccatttggtagtgcaagtagaaagcctcatgttgattct 25900368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 189 - 240
Target Start/End: Original strand, 40067818 - 40067869
Alignment:
Q  189 gagacctgttgtgccatttggtagtgcaagtagaaagcctcatgttgattct 240  Q
    ||||||||| | ||| ||||| ||||||||||||||||||||||||||||||    
T  40067818 gagacctgtcgcgccttttggaagtgcaagtagaaagcctcatgttgattct 40067869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University