View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18331_low_32 (Length: 250)

Name: NF18331_low_32
Description: NF18331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18331_low_32
NF18331_low_32
[»] chr2 (2 HSPs)
chr2 (1-76)||(43357165-43357240)
chr2 (158-224)||(43357017-43357083)


Alignment Details
Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 43357240 - 43357165
Alignment:
Q  1 cttgagtgggacactgccatcaatttattctaatcaattcaggagaacacatatgcttgcatgaatctggttcttt 76  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43357240 cttgagtgggacactgccatcaatttattctaatcaattcaggagaacacatatgcttgcatgaatctggttcttt 43357165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 158 - 224
Target Start/End: Complemental strand, 43357083 - 43357017
Alignment:
Q  158 cccgaccctcgttatcagcctaaggattttttgatcaaattttatcgcatatttatgtagtgtagtg 224  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43357083 cccgaccctcgttatcagcctaaggattttttgatcaaattttatcgcatatttatgtagtgtagtg 43357017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University