View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18331_low_12 (Length: 376)

Name: NF18331_low_12
Description: NF18331
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18331_low_12
NF18331_low_12
[»] chr5 (1 HSPs)
chr5 (19-228)||(8792884-8793093)


Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 19 - 228
Target Start/End: Complemental strand, 8793093 - 8792884
Alignment:
Q  19 tatgcagtaggacatacaaaacaaattgaggccaaaacttcagccaattttttatgcaattttcaatctaattccctgcaaacaatccttgtcaaactga 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  8793093 tatgcagtaggacatacaaaacaaattgaggccaaaacttcagccaatttttgatgcaattttcaatctaattccctgcaaacaatccttgtcaaactga 8792994  T
Q  119 ccaaatcaacttccctacatcaaaaggaactaatgcagtcccttgcgattgcaatggcttatgcaacacgattctttgagaaggaatggtgaagcaaaag 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8792993 ccaaatcaacttccctacatcaaaaggaactaatgcagtcccttgcgattgcaatggcttatgcaacacgattctttgagaaggaatggtgaagcaaaag 8792894  T
Q  219 gtcttctctg 228  Q
    ||||||||||    
T  8792893 gtcttctctg 8792884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University