View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18329_low_9 (Length: 340)

Name: NF18329_low_9
Description: NF18329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18329_low_9
NF18329_low_9
[»] chr2 (2 HSPs)
chr2 (225-336)||(3253529-3253639)
chr2 (153-213)||(3253626-3253686)


Alignment Details
Target: chr2 (Bit Score: 44; Significance: 5e-16; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 225 - 336
Target Start/End: Complemental strand, 3253639 - 3253529
Alignment:
Q  225 tttggatttcacaagactagtcgcttcaatcaac-aattgtgcattgcagtcctttgagtcgtt-tttgacttctaatggtaactcatcatcaccgcctt 322  Q
    ||||||||| |||| |||  ||||||||||  || ||||||||||||   |||||| |||| || |||||||||||||||||||||||||||||| ||||    
T  3253639 tttggattttacaacactcatcgcttcaattcactaattgtgcattg---tcctttaagtctttctttgacttctaatggtaactcatcatcaccacctt 3253543  T
Q  323 cttttcatctcact 336  Q
    |||||||| |||||    
T  3253542 cttttcatgtcact 3253529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 153 - 213
Target Start/End: Complemental strand, 3253686 - 3253626
Alignment:
Q  153 tataatgaagagacgcgtgtagggatcgatcatcacttggctattgatttggattttacaa 213  Q
    ||||| |||||||| ||| ||||| || |||||||||||||||||||||||||||||||||    
T  3253686 tataacgaagagacacgtttagggttctatcatcacttggctattgatttggattttacaa 3253626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University