View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18329_low_29 (Length: 221)

Name: NF18329_low_29
Description: NF18329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18329_low_29
NF18329_low_29
[»] chr2 (2 HSPs)
chr2 (89-219)||(7008720-7008850)
chr2 (1-47)||(7008892-7008938)


Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 89 - 219
Target Start/End: Complemental strand, 7008850 - 7008720
Alignment:
Q  89 ataaaacactatgtagttgtttaagtttgtgagnnnnnnnnagtgatgtttgtgtgattttatagaagatgatgatggaatgagagttagttgcttctac 188  Q
    |||| ||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7008850 ataacacactatgtagttgtttaagtttgtgagttttttttagtgatgtttgtgtgattttatagaagatgatgatggaatgagagttagttgcttctac 7008751  T
Q  189 gcaaaatggaaaatgggtgtagagtgtttgt 219  Q
    |||||||||||||||||||||||||||||||    
T  7008750 gcaaaatggaaaatgggtgtagagtgtttgt 7008720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 7008938 - 7008892
Alignment:
Q  1 tgtcatggtactagcacctttgttggtgcttgttttggaggatgaag 47  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
T  7008938 tgtcatggtactagcacctttgttggtgcttgttttggaggatgaag 7008892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University