View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18324_low_6 (Length: 257)

Name: NF18324_low_6
Description: NF18324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18324_low_6
NF18324_low_6
[»] chr4 (2 HSPs)
chr4 (114-230)||(22789470-22789582)
chr4 (12-123)||(22789965-22790076)
[»] chr5 (1 HSPs)
chr5 (158-187)||(32191419-32191448)
[»] chr1 (1 HSPs)
chr1 (156-200)||(1029124-1029168)


Alignment Details
Target: chr4 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 114 - 230
Target Start/End: Complemental strand, 22789582 - 22789470
Alignment:
Q  114 cttattactattgggtctagagataattagaatatttatgtcgcaattgctagagtagagaagtgtctcatgtgatctacggtggacggaccgatagtta 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    || ||||||||||    
T  22789582 cttattactattgggtctagagataattagaatatttatgtcgcaattgctagagtagagaagtgtctcatgtgatctacggt----gggccgatagtta 22789487  T
Q  214 aacacagctcaaaacat 230  Q
    |||||||||||||||||    
T  22789486 aacacagctcaaaacat 22789470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 12 - 123
Target Start/End: Complemental strand, 22790076 - 22789965
Alignment:
Q  12 agaacctgtgttactgcttttgattgtgttgtgtgtatgagattgtgggcttatggccaaggacaaaaggcaaatagacaacnnnnnnntggcacatacc 111  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||    
T  22790076 agaacgtgtgttactgcttttgattgtgttgtgtgtatgagattgtgggcttatggccaaggacaaaaggcaaatagacaacaaaaaaatggcacatacc 22789977  T
Q  112 tacttattacta 123  Q
    ||||||||||||    
T  22789976 tacttattacta 22789965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 158 - 187
Target Start/End: Original strand, 32191419 - 32191448
Alignment:
Q  158 aattgctagagtagagaagtgtctcatgtg 187  Q
    ||||||||||||||||||||||||||||||    
T  32191419 aattgctagagtagagaagtgtctcatgtg 32191448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 200
Target Start/End: Complemental strand, 1029168 - 1029124
Alignment:
Q  156 gcaattgctagagtagagaagtgtctcatgtgatctacggtggac 200  Q
    ||||||||||| || |||||||||| |||||||||||| ||||||    
T  1029168 gcaattgctagggtggagaagtgtcccatgtgatctacagtggac 1029124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University