View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18322_high_14 (Length: 378)

Name: NF18322_high_14
Description: NF18322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18322_high_14
NF18322_high_14
[»] chr8 (1 HSPs)
chr8 (165-285)||(24942002-24942119)


Alignment Details
Target: chr8 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 165 - 285
Target Start/End: Original strand, 24942002 - 24942119
Alignment:
Q  165 aggtgtttgtttgagtacgtatagagacttggatgagtcactatgtgagttttagaggaaagttacttcaaaaacgcatatgagcatattgacatatgtt 264  Q
    |||||||||||||||   ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||    
T  24942002 aggtgtttgtttgag---gtatagagacttggatgtgtcactatgtgagttttagaggaaagttacttccaaaacgcatatgagcatattgatatatgtt 24942098  T
Q  265 gttctattagttacatgttgc 285  Q
    |||||||||||||||||||||    
T  24942099 gttctattagttacatgttgc 24942119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University