View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18320_low_40 (Length: 204)

Name: NF18320_low_40
Description: NF18320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18320_low_40
NF18320_low_40
[»] chr2 (1 HSPs)
chr2 (24-189)||(5931118-5931283)


Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 24 - 189
Target Start/End: Complemental strand, 5931283 - 5931118
Alignment:
Q  24 atgatcaacctatgtcacccaaaacatggccaagataaaatccaaatggctgctgccttgttttcttgctctgctcccttgctcccaattacctttgaaa 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5931283 atgatcaacctatgtcacccaaaacatggccaagataaaatccaaatggctgctgccttgttttcttgctctgctcccttgctcccaattacctttgaaa 5931184  T
Q  124 aatggcaaacaaagaagctgaaataagaaacattttggtcaacatgtttcgtacattgttcatctc 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  5931183 aatggcaaacaaagaagctgaaataagaaacattttggtcaacatgtttcgtacattgttcttctc 5931118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University