View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18317_low_89 (Length: 264)

Name: NF18317_low_89
Description: NF18317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18317_low_89
NF18317_low_89
[»] chr7 (2 HSPs)
chr7 (158-247)||(34981267-34981356)
chr7 (48-134)||(34981166-34981253)


Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 158 - 247
Target Start/End: Original strand, 34981267 - 34981356
Alignment:
Q  158 gtttgctatgatttacttttgtagttcagtgaatgaattatgaatgcttgtgagtatgatgtatggacctagaactgcacttcaataatc 247  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||    
T  34981267 gtttgctgtgatttacttttgtagttcagtgaatgaattatgaatgcttctgagtatgatgtatggacctcgaactgcacttcaataatc 34981356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 48 - 134
Target Start/End: Original strand, 34981166 - 34981253
Alignment:
Q  48 atgttatatctaattt-gttgtcaaatttaatgtcaatttcaggtattaaaacagagctcgtcaatgtttgttaggaagtatcttctc 134  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  34981166 atgttatatctaattttgttgtcaaatttaatgtcaatttcaggtattaaaacagagctcgtcaatgtttgttaggaagtatcctctc 34981253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University