View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18317_low_60 (Length: 321)

Name: NF18317_low_60
Description: NF18317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18317_low_60
NF18317_low_60
[»] chr3 (1 HSPs)
chr3 (168-302)||(2851059-2851193)


Alignment Details
Target: chr3 (Bit Score: 123; Significance: 4e-63; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 168 - 302
Target Start/End: Original strand, 2851059 - 2851193
Alignment:
Q  168 aaacttcacaagacttttacaatttttgtaaacaacaccattccaacgtagaattttcagaaccggaaaattaaaatcgaaatctcttacgattatcttt 267  Q
    |||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2851059 aaacttcacaagacttttacgatttttgtaaagaacaccattccaacgtagaattttcagaaccggaaaattaaaatcgaaatctcttacgattatcttt 2851158  T
Q  268 ttcaaatgcagaacttgaagattcatacaagtaaa 302  Q
    ||||||| |||||||||||||||||||||||||||    
T  2851159 ttcaaattcagaacttgaagattcatacaagtaaa 2851193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University