View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18317_high_111 (Length: 234)

Name: NF18317_high_111
Description: NF18317
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18317_high_111
NF18317_high_111
[»] chr3 (1 HSPs)
chr3 (14-234)||(47657691-47657911)


Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 14 - 234
Target Start/End: Original strand, 47657691 - 47657911
Alignment:
Q  14 aaaacaatggatgttaatacttatgatgaaatttttgctggaatgacgaatccaaaacaccacgaaaaggtgaagggaattttggtttctctatgtaacg 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47657691 aaaacaatggatgttaatacttatgatgaaatttttgctggaatgacgaatccaaaacaccacgaaaaggtgaagggaattttggtttctctatgtaacg 47657790  T
Q  114 gtgctgttgagactttggttaaaacatctcatcgggttttgactaatccaaaaggtaaatctgatttgagttcacctagggaaaacgagcgtttgaaacc 213  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||    
T  47657791 gtgctgttgagactttggttaaaacatctcatcaggttttgactaatccaaaaggtaaatctgatttgagttcacctagggaaaacgggcttttgaaacc 47657890  T
Q  214 ggaagcttatcttcagaaatt 234  Q
    |||||||||||||||||||||    
T  47657891 ggaagcttatcttcagaaatt 47657911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University