View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18315_low_70 (Length: 287)

Name: NF18315_low_70
Description: NF18315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18315_low_70
NF18315_low_70
[»] chr6 (2 HSPs)
chr6 (10-164)||(3837248-3837402)
chr6 (211-274)||(3837116-3837179)


Alignment Details
Target: chr6 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 10 - 164
Target Start/End: Complemental strand, 3837402 - 3837248
Alignment:
Q  10 ataattctcgtgatccccccatagtatatatttttgttgctgatgaattgtttttgccctaggacacaagttcaaatattctttgaatcattgaataaat 109  Q
    ||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  3837402 ataattctcgtgatccccccatagtatatatttttgttgttggtgaattgtttttgccctaggacacaagttcaaatattctttgaatcattgaagaaat 3837303  T
Q  110 attcgagatatggttcttgtatggcaataaaatagttgttgactagaattcgtag 164  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3837302 attcgagatatggttcttgtatggcaataaaatagttgttgactagaattcgtag 3837248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 211 - 274
Target Start/End: Complemental strand, 3837179 - 3837116
Alignment:
Q  211 agatagaggaactagatgtctttggtcttttggtcacatttaatgggttgagtttgttgattct 274  Q
    |||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||    
T  3837179 agatagaggaactagatgactttggtcttttggtcacatttaatgggatgagtttgttgattct 3837116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University