View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18315_low_41 (Length: 381)

Name: NF18315_low_41
Description: NF18315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18315_low_41
NF18315_low_41
[»] chr6 (1 HSPs)
chr6 (18-156)||(787553-787689)
[»] chr1 (1 HSPs)
chr1 (229-275)||(20226519-20226565)
[»] chr8 (1 HSPs)
chr8 (331-368)||(7277294-7277331)


Alignment Details
Target: chr6 (Bit Score: 96; Significance: 5e-47; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 18 - 156
Target Start/End: Original strand, 787553 - 787689
Alignment:
Q  18 tttttcactgataccgattcagtttcacgttcttgattcctttcttgcttcaatttcgtttttctgatctcgtgattgaggaattccttccatcgattgt 117  Q
    |||||||||||| |||||||||| ||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  787553 tttttcactgattccgattcagtgtcacgttcttgattcctttcttatttcaatttcgtttttctgatctcgtgattgaggaattccttgcatcgattgt 787652  T
Q  118 tcattccttattttcttttgatttagtaatttctttttc 156  Q
    ||||||||| |||||  ||||||| | ||||||||||||    
T  787653 tcattccttcttttc--ttgatttggcaatttctttttc 787689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 229 - 275
Target Start/End: Complemental strand, 20226565 - 20226519
Alignment:
Q  229 ttttcccccaaatcctagggtttcacaatttcttgttcaatttcacc 275  Q
    ||||||||||||||||||||||||  |||||||||||||||||||||    
T  20226565 ttttcccccaaatcctagggtttcgaaatttcttgttcaatttcacc 20226519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 331 - 368
Target Start/End: Complemental strand, 7277331 - 7277294
Alignment:
Q  331 ttactcgatcgcaatttccagtttcgattcgaatccgt 368  Q
    ||||||||||||||||||||||||||||||||||||||    
T  7277331 ttactcgatcgcaatttccagtttcgattcgaatccgt 7277294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University