View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18315_high_61 (Length: 302)

Name: NF18315_high_61
Description: NF18315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18315_high_61
NF18315_high_61
[»] chr1 (2 HSPs)
chr1 (18-115)||(24551939-24552036)
chr1 (239-292)||(24551791-24551844)


Alignment Details
Target: chr1 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 18 - 115
Target Start/End: Complemental strand, 24552036 - 24551939
Alignment:
Q  18 aacacaatacaatatgaagtagaattagcaacaacttttccttaaaactagcattgcgtgcgtactcttcttaactttccaacaatactatatttccc 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||    
T  24552036 aacacaatacaatatgaagtagaattagcaacaacttttccttaaaactagcattgcgtgcgtaatcttcttaactttccaacactactatatttccc 24551939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 239 - 292
Target Start/End: Complemental strand, 24551844 - 24551791
Alignment:
Q  239 cacccacatcaagcacaaggcttgcctaataggaggacaaaatagtataatcta 292  Q
    |||||||||||||| |||||  |||||||||||||||||||||||||| |||||    
T  24551844 cacccacatcaagcgcaaggtctgcctaataggaggacaaaatagtattatcta 24551791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University