View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18314_high_14 (Length: 271)

Name: NF18314_high_14
Description: NF18314
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18314_high_14
NF18314_high_14
[»] chr4 (1 HSPs)
chr4 (14-253)||(13122031-13122270)


Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 14 - 253
Target Start/End: Original strand, 13122031 - 13122270
Alignment:
Q  14 atcacattctaaaacactttttccttttggtgtttaaaacttgcagccagtgcgcgagatgcatttcctagagattcatcactttcactgagatcatttg 113  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  13122031 atcacattctaaaacactttttccttctggtgtttaaaacttgcagccagtgcgcgagatgcatttcctagagattcatcactttcactgagatcatttg 13122130  T
Q  114 gcagtggtaacggtcaaagcagtggctcagaatccaaattttctgccgatgagaaatatggttcaacgcattcttcaactgccatggactatcagagtta 213  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  13122131 gcagtggtaacggtgaaagcagtggctcagaatccaaattttctgccgatgagaaatatggttcaacgcattcttcaactgctatggactatcagagtta 13122230  T
Q  214 tacttctgtgatagatgttatggatgatagcactgatgac 253  Q
    ||||||||||||||||||||||||||||| ||||||||||    
T  13122231 tacttctgtgatagatgttatggatgataccactgatgac 13122270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University