View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18309_low_55 (Length: 201)

Name: NF18309_low_55
Description: NF18309
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18309_low_55
NF18309_low_55
[»] chr3 (1 HSPs)
chr3 (1-201)||(25495197-25495397)
[»] chr6 (1 HSPs)
chr6 (75-152)||(24222332-24222409)


Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 25495397 - 25495197
Alignment:
Q  1 ttaccttctcttttcttcttctctttgtattttcattagcctttagtacactagttgatgaacaagtaatagtggacacaaatggaaaccctattttccc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  25495397 ttaccttctcttttcttcttctctttgtattttcattagcctttagtacactagttgatgaacaagtagtagtggacacaaatggaaaccctattttccc 25495298  T
Q  101 tggtgggagatactatctcatgccacctatctttggagcagcaggtggtggagtaaagcttggtcatgatacagaaagctcaacatgtccagttgcagta 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25495297 tggtgggagatactatctcatgccacctatctttggagcagcaggtggtggagtaaagcttggtcatgatacagaaagctcaacatgtccagttgcagta 25495198  T
Q  201 t 201  Q
    |    
T  25495197 t 25495197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 75 - 152
Target Start/End: Complemental strand, 24222409 - 24222332
Alignment:
Q  75 gacacaaatggaaaccctattttccctggtgggagatactatctcatgccacctatctttggagcagcaggtggtgga 152  Q
    ||||||||||||||||| ||||| |||||||| | || |||| | |||||| | |||||||||||||| |||||||||    
T  24222409 gacacaaatggaaaccccatttttcctggtggcacattctatattatgccatcaatctttggagcagctggtggtgga 24222332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University