View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18300_high_10 (Length: 287)

Name: NF18300_high_10
Description: NF18300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18300_high_10
NF18300_high_10
[»] chr3 (2 HSPs)
chr3 (10-271)||(28617956-28618217)
chr3 (40-271)||(28622253-28622484)


Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 10 - 271
Target Start/End: Complemental strand, 28618217 - 28617956
Alignment:
Q  10 agatgaatcatcaccaacgatattggacgggttatggcaaggtgctgtgttaatatcgccgttcttcttctggggcacttccatggtggcaatgaaagaa 109  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28618217 agatgaatcatcgccaacgatattggacgggttatggcaaggtgctgtgttaatatcgccgttcttcttctggggcacttccatggtggcaatgaaagaa 28618118  T
Q  110 gtgattccgaaacacggtccnnnnnnngtttcttcttttcgtctcattcctgctgggttccttcttgttgcttttgctgcttctagaggaagggagtttc 209  Q
    ||||||||||||||||||||       |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||    
T  28618117 gtgattccgaaacacggtcctttttttgtttcttcttttcgtctcattcctgccgggttccttcttgttgcttttgctgcttctagaagaagggagtttc 28618018  T
Q  210 cttctagcttcaatgcctggctctccatcgccatatttgctctcgtcgatgctgcttgcttt 271  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28618017 cttctagcttcaatgcctggctctccatcgccatatttgctctcgtcgatgctgcttgcttt 28617956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 40 - 271
Target Start/End: Complemental strand, 28622484 - 28622253
Alignment:
Q  40 gttatggcaaggtgctgtgttaatatcgccgttcttcttctggggcacttccatggtggcaatgaaagaagtgattccgaaacacggtccnnnnnnngtt 139  Q
    ||||||| ||||||| ||||||||||| |||||||| |||||||| ||| | |||||||| ||||||||||||||||| ||  |||||||       |||    
T  28622484 gttatgggaaggtgcagtgttaatatcaccgttctttttctggggaactgcaatggtggcgatgaaagaagtgattcctaattacggtccttttttcgtt 28622385  T
Q  140 tcttcttttcgtctcattcctgctgggttccttcttgttgcttttgctgcttctagaggaagggagtttccttctagcttcaatgcctggctctccatcg 239  Q
     | ||||||||| | ||||| |||||||| |||||||||||||||||||||| |||||||||||  || |||||| | |||||||| ||||| |||||||    
T  28622384 gcgtcttttcgtttaattccagctgggtttcttcttgttgcttttgctgcttttagaggaagggctttaccttctggtttcaatgcttggctttccatcg 28622285  T
Q  240 ccatatttgctctcgtcgatgctgcttgcttt 271  Q
    | |||||||| || ||||||||||||||||||    
T  28622284 cgatatttgcacttgtcgatgctgcttgcttt 28622253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University