View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18298_low_7 (Length: 203)

Name: NF18298_low_7
Description: NF18298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18298_low_7
NF18298_low_7
[»] chr6 (1 HSPs)
chr6 (18-188)||(29235184-29235355)


Alignment Details
Target: chr6 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 188
Target Start/End: Complemental strand, 29235355 - 29235184
Alignment:
Q  18 atctttaccatgatgtt-agcaacaatggaagaaggattaaggtgaattgaacttctagttttggtttctgaaagcacgttgtttgaaaatgctaaggat 116  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  29235355 atctttaccatgatgtttagcaacaatggaagaaggattaaggtgaattgaacttctagctttggtttctgaaagcacgttgtttgaaaatgctaaggat 29235256  T
Q  117 ttaagtctcttgcgttctatggtttctgggtttgttgcgtcagcttcttcgtcgctgcgtgttttcttcttc 188  Q
    || |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  29235255 ttgagtctcttgcgttctatggtttctgggtttgttgcgtcggcttcttcgtcgctgcgtgttttcttcttc 29235184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University