View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18295_low_6 (Length: 314)

Name: NF18295_low_6
Description: NF18295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18295_low_6
NF18295_low_6
[»] chr4 (2 HSPs)
chr4 (16-166)||(29135526-29135676)
chr4 (224-310)||(29135382-29135468)


Alignment Details
Target: chr4 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 16 - 166
Target Start/End: Complemental strand, 29135676 - 29135526
Alignment:
Q  16 agtttcaacctttatcactacttgtggaatcttaggtagcccttacgaaaaccctaacatcaacccgttgttcataggaattcccgattttcataaattg 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29135676 agtttcaacctttatcactacttgtggaatcttaggtagcccttacgaaaaccctaacatcaacccgttgttcataggaattcccgattttcataaattg 29135577  T
Q  116 ccaaaaatatcaaattgatgtgtcagttgatgatgagtgtgtttgttaccg 166  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  29135576 ccaaaaatatcaacttgatgtgtcagttgatgatgagtgtgtttgttaccg 29135526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 224 - 310
Target Start/End: Complemental strand, 29135468 - 29135382
Alignment:
Q  224 acttgacatgaacacaattaactcatcaccattcataaaattggtctcaatacaagaaaaaatatgattataaatgtgagaataata 310  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29135468 acttgacatgaacacaattaactcatcatcattcataaaattggtctcaatacaagaaaaaatatgattataaatgtgagaataata 29135382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University