View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18289_low_15 (Length: 211)

Name: NF18289_low_15
Description: NF18289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18289_low_15
NF18289_low_15
[»] chr5 (1 HSPs)
chr5 (19-204)||(11474437-11474622)


Alignment Details
Target: chr5 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 19 - 204
Target Start/End: Original strand, 11474437 - 11474622
Alignment:
Q  19 gaaagtactttttccacatcctgaatcagctgctagaccaatcacaattgtctgtgagtcacctgcaccacatgttatcaagtatcttctgttgttactg 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||    
T  11474437 gaaagtactttttccacatcctgaatcagctgctagaccaatcacaattgtctgtgagtcacctgctccacatgttatcaggtatcttctgttgttactg 11474536  T
Q  119 ttagttcttctgttgctgctctttttggttgttgtgtagaacactacctgtttttgattaaaaccaacatgtgtttttgatgatgt 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11474537 ttagttcttctgttgctgctctttttggttgttgtgtagaacactacctgtttttgattaaaaccaacatgtgtttttgatgatgt 11474622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University